ID: 1054764987

View in Genome Browser
Species Human (GRCh38)
Location 9:69035850-69035872
Sequence CGGCCGCGGGACCCGGGTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054764987_1054764997 9 Left 1054764987 9:69035850-69035872 CCCTCACCCGGGTCCCGCGGCCG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1054764997 9:69035882-69035904 GCCCCACTCTGCGGCCGCCGTGG 0: 1
1: 0
2: 3
3: 12
4: 168
1054764987_1054764996 0 Left 1054764987 9:69035850-69035872 CCCTCACCCGGGTCCCGCGGCCG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1054764996 9:69035873-69035895 GCAGAGTTGGCCCCACTCTGCGG 0: 1
1: 1
2: 2
3: 22
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054764987 Original CRISPR CGGCCGCGGGACCCGGGTGA GGG (reversed) Exonic
900244529 1:1631141-1631163 CGGCGTCGGGCCCAGGGTGACGG - Intergenic
900245064 1:1632817-1632839 TGGGCCCGGGACCCGGGTGGGGG - Exonic
900256295 1:1699976-1699998 TGGGCCCGGGACCCGGGTGGGGG - Intronic
900500930 1:3004229-3004251 CAGCTGAGGGACCAGGGTGAGGG - Intergenic
901676371 1:10888467-10888489 CGCCTGGGAGACCCGGGTGACGG - Intergenic
902916839 1:19644553-19644575 CGGCCGCGGGCACCGGGTGGAGG + Intronic
905449308 1:38046700-38046722 CTGCCGCGGGGCCCCGGTGGCGG - Exonic
908293160 1:62688107-62688129 AGGCCGCGGGATCCCGGTGCCGG + Intronic
914869149 1:151458889-151458911 GGGCCGCGGGAGCCGCGCGAAGG - Intronic
915348288 1:155209060-155209082 GGGCCGCGGGCCTCGGGGGAGGG - Exonic
915616907 1:157045987-157046009 CGGCCGCGGGAACCGAGGCAGGG - Intergenic
918056079 1:181022941-181022963 CGGCCGAGGGTCCCGGGGGTGGG - Intronic
923630802 1:235648789-235648811 CAGCCGCGGGGCCGGGGAGACGG + Intronic
1065660278 10:27998919-27998941 CGGCGGCGGCGCCCGGGGGAGGG - Intronic
1077051530 11:568913-568935 GGCCCGCGGGACGCGGGTGCGGG - Intergenic
1078057346 11:8019087-8019109 CCCCCGCGGGACCCGAGCGAGGG + Intergenic
1078659831 11:13277871-13277893 CCGCCGCGGGATCCGAGTGCGGG + Exonic
1081773976 11:45665437-45665459 CGGACGCGGGACCCGGGGCCGGG + Exonic
1083883077 11:65557963-65557985 GGGCCGCAGGACCCGGGGGAGGG + Exonic
1084014658 11:66371440-66371462 CGGCCGAGGGAGTCGGCTGATGG + Intronic
1085295893 11:75431450-75431472 GGGCCGCTGGACCCAGGTGGAGG + Intergenic
1085476998 11:76795158-76795180 AGACCTCGGGCCCCGGGTGAGGG - Intronic
1091571560 12:1691198-1691220 CGGCGACGGGCTCCGGGTGAGGG + Intronic
1095440793 12:42237778-42237800 CGGCCGCGGGGCCCGGGCACCGG - Intronic
1098161035 12:67648637-67648659 CGGCCGGGGGAGCCGGGGGCGGG + Intronic
1098161129 12:67648943-67648965 CGGCGGCGGGCCCCGGCCGAGGG + Exonic
1102197407 12:111034848-111034870 CGGCGGCGGCCCCCGGGTGGCGG - Intronic
1103846300 12:123903917-123903939 CGGCTGCGAGACCCGTGTGTGGG - Intronic
1105049678 12:133037462-133037484 CGTGCGCGGGACACGGGGGACGG + Intronic
1106735650 13:32586221-32586243 CCGCCGCGGGGCCCGCGAGAAGG - Intergenic
1110048436 13:70860756-70860778 AGGCCTCTGGACCCGTGTGATGG + Intergenic
1113937324 13:114001373-114001395 CGGCCGCGGGCTCGGGGTCAGGG + Intronic
1113937338 13:114001428-114001450 CGGCCGCGGGCTCGGGGTCAGGG + Intronic
1116928717 14:50668424-50668446 CGGCGGCGGGACTCGGGTGCCGG + Intergenic
1123048539 14:105529916-105529938 CGGCCGCGGGACCCCAGGCACGG - Exonic
1125508802 15:40282073-40282095 CGGCCACGGGACCTGTGTGCAGG - Exonic
1129189203 15:73927653-73927675 CCGCCTCGGGACCGGGGTCAGGG - Exonic
1131268422 15:90932382-90932404 CGGCTGCGGCACCTGGGTGGTGG - Intronic
1132837080 16:1959552-1959574 AGGCCGCGGGACCCGGACGGAGG + Exonic
1135136028 16:19885710-19885732 CGGCCGTGGGACCTGCTTGAAGG + Intronic
1136284560 16:29233404-29233426 CGGCCGTGGCACCCGGCTCAGGG - Intergenic
1138520018 16:57565728-57565750 CGGCCCAGGGACTGGGGTGAAGG + Intronic
1138660733 16:58515652-58515674 GGGGCGCGGGACCCGCGGGAGGG - Intronic
1142089589 16:88202917-88202939 CGGCTGCGGCACCCGGCTCAGGG - Intergenic
1142228530 16:88888791-88888813 TGGCCCCGGGCCCCGGGTGGGGG + Intronic
1142302786 16:89268445-89268467 CGGCCGCAGGACGCAGGCGAGGG - Exonic
1142549900 17:732296-732318 CGGCCGCGGGGCCCAGGCGGAGG - Intergenic
1142671941 17:1491552-1491574 CGGCCGCGGGGGGCGGGTGTGGG - Intronic
1147325428 17:39667547-39667569 GCGGCGCCGGACCCGGGTGAGGG - Intergenic
1147336654 17:39730362-39730384 GGCCCGCGGGACCAGGGTGCGGG + Intronic
1147793084 17:43025293-43025315 CGGCGGCGGGGCCCGGGAGAGGG + Exonic
1148684799 17:49495399-49495421 CTGCCGCGGGAGGCGGGCGATGG + Exonic
1148819729 17:50353651-50353673 CGGCCACTGGACCCTGGCGAGGG + Exonic
1152069652 17:78128366-78128388 CGGCTGGGGGACCTGGGTGGGGG + Intronic
1152070618 17:78132120-78132142 TGGTCGGGGGACCCGGGTGAAGG - Intronic
1152490037 17:80625043-80625065 CGGCCAGGTGACCCGGGGGAGGG + Intronic
1152563240 17:81089066-81089088 CTGCCGTGGGCCCCGGGTGGTGG + Intronic
1152809538 17:82375058-82375080 CGGCCGCCGGGCCCGCTTGAAGG - Exonic
1160392803 18:78547898-78547920 CGGCCCCGGGCCCCTGGTGTGGG + Intergenic
1160689766 19:456179-456201 CGGCCGCAGCCCCCGGGTGATGG + Intronic
1161150017 19:2702645-2702667 CGGCCGCGGGGCCCGAGCGCAGG - Exonic
1161308298 19:3578998-3579020 CAGCCGAGGGACCCTGGTGGGGG + Exonic
1162908396 19:13836655-13836677 CGGCCGTGGCACAGGGGTGAGGG + Intergenic
1163282103 19:16324579-16324601 CGGGGGCGGGGCCCGGGAGAGGG + Intergenic
1163437320 19:17303250-17303272 GGGCCGCGGGGCCCGGGTCGGGG + Exonic
1163508031 19:17719713-17719735 CGGCGGCGGGACCCGGGCTCCGG + Intronic
1164682350 19:30144438-30144460 CAGATGCGGGACCCGGGTCAGGG - Intergenic
1165064251 19:33219833-33219855 CGGCCACGGTACCTGGATGATGG + Intronic
1165824766 19:38699383-38699405 CGGCTGCCTGACCCCGGTGAGGG + Intronic
1166079346 19:40434040-40434062 CGGCCGGGGTACCCGGGAGGCGG - Intergenic
1166894695 19:46016168-46016190 CGGCCGCGGGAGCCGGGGTCGGG + Exonic
1168134117 19:54338869-54338891 GGGCCCCAGGACCCGGGTGCAGG - Exonic
925027613 2:621761-621783 CGGCCGCAGGACCGGGGCGAAGG - Intergenic
925725215 2:6865426-6865448 CGGCTGCGGGGCCCGGGTCCGGG - Exonic
927751451 2:25673704-25673726 CGGCCGCGGGGGCGGGGTGGAGG - Intergenic
927772719 2:25878062-25878084 TGGCCCAGGGACCCGGCTGAAGG - Intronic
928990762 2:37231385-37231407 CGGCCGCGGGCTCCGGGGAACGG - Intronic
937221242 2:120344362-120344384 CGGCCCGGGGAGCTGGGTGAGGG + Intergenic
937904863 2:127048177-127048199 CGGCCGCGCCACCCGGGCAAGGG - Exonic
940650358 2:156435649-156435671 CCGCCGGGGGAGCCGGGCGAGGG + Exonic
943185181 2:184598365-184598387 CGGCCGCGGGTCCCGGCGGCGGG + Exonic
946395440 2:219441899-219441921 GGGCCTCGGGAGCCGGGTGGGGG - Intronic
946418027 2:219550356-219550378 AGGCCAGGGGACCAGGGTGAGGG - Exonic
949019671 2:241734285-241734307 CGGCCGAGGGACCTGGGGGCCGG - Intergenic
1168871716 20:1134955-1134977 CGCCTGCTGGACCTGGGTGAGGG - Intronic
1172766667 20:37354797-37354819 CTGCCGCGTGCCCCGGGTGGTGG + Intronic
1174790268 20:53471699-53471721 TGGCAGAGGGACCCAGGTGAAGG + Intronic
1174870133 20:54174092-54174114 GGGACGCGGGACCCAGGGGAGGG + Intergenic
1176310223 21:5145378-5145400 AGGCTGGGGCACCCGGGTGACGG + Intronic
1178761309 21:35405306-35405328 CGGCCGCAGGACTTGGTTGAAGG - Intronic
1179511888 21:41878984-41879006 CGGCGGCGGGACCCGGCGGGCGG + Exonic
1179626829 21:42653740-42653762 CCGCCGCGGGAGGCGGGGGAGGG - Exonic
1179846833 21:44116658-44116680 AGGCTGGGGCACCCGGGTGACGG - Intronic
1179874055 21:44258639-44258661 CGGCCCCGGGACCTCGGGGAAGG - Exonic
1179919483 21:44499795-44499817 CAGCCGCAGGACCCTGGAGAGGG + Exonic
1180342522 22:11629415-11629437 GGGCGGTGGGAGCCGGGTGATGG - Intergenic
1180559139 22:16601729-16601751 GGGCCGCGGGGCCCGGGCGGCGG - Intergenic
1180649922 22:17369417-17369439 CGGACGCGGGGCCTGGGGGAGGG - Exonic
1183683721 22:39350060-39350082 CGGCTGCCGGACCAGGGTGTAGG - Exonic
1184842252 22:47058863-47058885 GGCCCGCTGGACCCAGGTGAAGG + Intronic
1185138601 22:49087975-49087997 CCGCCCCGGGCCCCGCGTGAGGG - Intergenic
1185270990 22:49929302-49929324 TGCCCGCGGGACACGGGGGACGG + Intergenic
1185313873 22:50170566-50170588 GGGCCGCGGGCCGCGGGAGAGGG - Intergenic
1185336179 22:50271784-50271806 CGGCCGCGGCCGCCGGGGGAGGG + Intergenic
957193548 3:77039871-77039893 CGGGGGCTGGACCCGGGCGAGGG + Intronic
968161628 3:196432014-196432036 CGGCCCGGGGACCCGGGGGCGGG - Intronic
968640389 4:1711850-1711872 TGGGCGCGGGACCCGGGGGTCGG - Intronic
969084041 4:4642014-4642036 CAGCCGCTGGACCGGGGTGGGGG - Intergenic
985549206 5:524610-524632 AGGCCGCGGGCTCCGGGGGAGGG - Intergenic
988100440 5:26669678-26669700 CGGCCGCAGGACGCAGGCGAGGG - Intergenic
992474261 5:77087112-77087134 CGGCCGCGTTTCCCGGGTAAAGG - Exonic
999287847 5:150404872-150404894 CTGCAGCTGGACCCGGGTGTTGG - Intronic
1001724872 5:173888383-173888405 CGGCTGCGGGACCCGGGCACCGG + Exonic
1002281151 5:178130853-178130875 CGCCCGCGGGAACCGGGCGGCGG - Intergenic
1003107931 6:3229440-3229462 CGGCCGGCGTGCCCGGGTGAGGG + Intronic
1004492395 6:16129172-16129194 CGGCCGCGGGGCCCCGGACAAGG + Exonic
1006337403 6:33427889-33427911 CGGCGGCGGGGCCCGGGCAACGG + Intronic
1007431493 6:41779845-41779867 CTGCAGCGGGACCCGGGAGCGGG - Exonic
1007714917 6:43850382-43850404 CGCCAGTGGGACCTGGGTGAGGG - Intergenic
1017672043 6:156777935-156777957 CGGCCGCGGCGCCCGCGTTATGG - Exonic
1018046312 6:159969270-159969292 CGGGCGCGGGCCCCAGGTGGGGG - Exonic
1019913222 7:4114259-4114281 CGGACGCGGGAGTCAGGTGAGGG + Exonic
1020001190 7:4756898-4756920 CAGATGCGGGACCAGGGTGAGGG - Intronic
1020288885 7:6707018-6707040 CGGCGGCGGGTCCCGGGAGGCGG - Intergenic
1024262437 7:47582275-47582297 AGGGCGGGGGACCCCGGTGAAGG - Intronic
1024613227 7:51084904-51084926 CGGCTGCAGGAGCCGGGAGAGGG - Intronic
1026807097 7:73435467-73435489 CGGCCGCGGGGCCCGGAGGCCGG + Exonic
1029640424 7:101816441-101816463 CCGCCGCGGGACCGGGGAGGGGG + Intronic
1029730133 7:102433500-102433522 CGGCCGCGGGGGCGGGGTGGAGG + Intronic
1034222963 7:149460070-149460092 CGGCCTCGGGGCCCCGGGGACGG - Intronic
1034461274 7:151199310-151199332 CGGCCGCGGGGCGGGGGTGCAGG - Intronic
1043401899 8:79892048-79892070 AGGCCGCGGGAGCCGCGGGAGGG - Intergenic
1044115479 8:88328553-88328575 CGGCTGCGGGAGCCAGGGGAAGG + Intergenic
1049324409 8:142014586-142014608 GGGCCGTGGCACCCGGGGGAGGG - Intergenic
1049585355 8:143430403-143430425 CGGGCGCGGGCCCCGGGCGATGG - Exonic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1054764987 9:69035850-69035872 CGGCCGCGGGACCCGGGTGAGGG - Exonic
1056182855 9:84102423-84102445 CGGCCACGAGCCCCGGGGGAAGG - Intergenic
1057516867 9:95729271-95729293 AGCCCGCGGGACCCGGGCGGTGG - Intergenic
1058467801 9:105245534-105245556 AGGCCGCGGGGCCCGGGTCACGG - Intronic
1058880069 9:109278173-109278195 CGTCCACCGGACCCGGGAGAAGG - Intronic
1060995579 9:127873510-127873532 CTGCCGGGGGAGGCGGGTGATGG - Intronic
1061402793 9:130377667-130377689 CGGCTGCAGGTCCTGGGTGAAGG + Intronic
1185643378 X:1600459-1600481 TGGCCGCGGGAGCCGAGGGATGG + Intronic
1192212570 X:69137169-69137191 CGCACGGGGGACCCGGGGGACGG - Intergenic
1199335952 X:146619554-146619576 CGGCCGCAGGACGCAGGCGAGGG - Intergenic
1200247581 X:154534301-154534323 GGGCCGGGGGACCAGGGTGGGGG - Intronic