ID: 1054769474

View in Genome Browser
Species Human (GRCh38)
Location 9:69070246-69070268
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 2, 1: 3, 2: 6, 3: 25, 4: 257}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054769469_1054769474 2 Left 1054769469 9:69070221-69070243 CCCATCTCAAAAAAAAAAAAAAG 0: 254
1: 4626
2: 20415
3: 27647
4: 64522
Right 1054769474 9:69070246-69070268 AGAAAACGGCCCAGGAAGGCTGG 0: 2
1: 3
2: 6
3: 25
4: 257
1054769468_1054769474 3 Left 1054769468 9:69070220-69070242 CCCCATCTCAAAAAAAAAAAAAA 0: 1710
1: 4662
2: 23038
3: 43204
4: 191852
Right 1054769474 9:69070246-69070268 AGAAAACGGCCCAGGAAGGCTGG 0: 2
1: 3
2: 6
3: 25
4: 257
1054769466_1054769474 26 Left 1054769466 9:69070197-69070219 CCAGCCTGGGTGACACAGTGAGA 0: 1468
1: 36819
2: 91431
3: 177348
4: 206241
Right 1054769474 9:69070246-69070268 AGAAAACGGCCCAGGAAGGCTGG 0: 2
1: 3
2: 6
3: 25
4: 257
1054769467_1054769474 22 Left 1054769467 9:69070201-69070223 CCTGGGTGACACAGTGAGACCCC 0: 56
1: 2078
2: 26542
3: 93219
4: 204726
Right 1054769474 9:69070246-69070268 AGAAAACGGCCCAGGAAGGCTGG 0: 2
1: 3
2: 6
3: 25
4: 257
1054769470_1054769474 1 Left 1054769470 9:69070222-69070244 CCATCTCAAAAAAAAAAAAAAGA 0: 4507
1: 92147
2: 69591
3: 83380
4: 123011
Right 1054769474 9:69070246-69070268 AGAAAACGGCCCAGGAAGGCTGG 0: 2
1: 3
2: 6
3: 25
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900504304 1:3021625-3021647 ACAAAGCGGCCCTGGAGGGCTGG + Exonic
901440549 1:9275426-9275448 AGCATACGGCCCAGGAAGACGGG - Intergenic
902686281 1:18079778-18079800 AGAAAAAGGGCCAGGAAGAGGGG + Intergenic
903221097 1:21870099-21870121 GGGAAATGGCCCAGGAAAGCTGG + Intronic
904288726 1:29470372-29470394 AGGGACCAGCCCAGGAAGGCAGG + Intergenic
905446194 1:38029860-38029882 AGAAAACAGCCCAGGGATCCTGG - Intergenic
905790620 1:40787386-40787408 AGAGAAGGGCTCAGGAAGGAGGG + Intronic
905888986 1:41508090-41508112 AGAAAAATGCCCAGGAGAGCTGG + Exonic
907516564 1:54996880-54996902 AGAAAAGGGGCGAAGAAGGCTGG + Intergenic
908347697 1:63252200-63252222 AGAAAATGGGCCAGGCAGGGTGG - Intergenic
910214192 1:84825759-84825781 AGAGAAAGGCCCAGGAGGCCGGG + Intronic
910541463 1:88363077-88363099 AGATGAAGGCCCAGGAAAGCCGG + Intergenic
911684601 1:100760532-100760554 AGAAAGATGCTCAGGAAGGCAGG - Intergenic
912453698 1:109783760-109783782 ACAGAGCAGCCCAGGAAGGCTGG - Intergenic
915252417 1:154600048-154600070 AGAAAACGGCTTAGGGAGGAGGG + Intronic
915331692 1:155116685-155116707 GGAAAAAGGACCAGGAAGGAGGG + Intergenic
915528914 1:156492264-156492286 AGTAAATGGCCCAGGACAGCAGG + Intronic
915731965 1:158060214-158060236 AGAACCCTGCCCAGGAATGCAGG - Intronic
916436394 1:164781703-164781725 AAAAGAAGGCCCAGGAAGTCCGG - Intronic
916490413 1:165297427-165297449 TGAAAACAGCCCTGGAAGTCTGG + Intronic
918699489 1:187589747-187589769 AGCCAGCGGCCCAGGAAAGCTGG - Intergenic
919726500 1:200888060-200888082 AGAAACCAGCCCAGGATTGCTGG + Intergenic
920005898 1:202833670-202833692 AGAAGAGGGCCCAGGAAGGGTGG - Intergenic
920556879 1:206910260-206910282 AGGAAAAGGCCCAGGATGGTCGG + Exonic
921563760 1:216691012-216691034 AGAAAATGGCAAATGAAGGCAGG - Intronic
922721518 1:227902469-227902491 AGACAAAGGCCCAGGAGGCCGGG - Intergenic
923111892 1:230897518-230897540 AGAAACCAGCCAAGGAACGCTGG - Intergenic
924777912 1:247123489-247123511 AAAAAACGGCTCACGTAGGCCGG - Intronic
1062856284 10:781046-781068 GGAAAGCAGCCCAGGAGGGCAGG - Intergenic
1063526210 10:6788727-6788749 ATAAAAGGGCCCTGGAAGGCAGG + Intergenic
1063568455 10:7193017-7193039 AGAGAAAGCCCCAGGAAGCCTGG - Intronic
1064064199 10:12166787-12166809 AGAAAATGGCCCAGGAACACTGG + Exonic
1064791036 10:18958276-18958298 AGAAAATGGTCCAGGAAGGTTGG - Intergenic
1065655507 10:27944756-27944778 AGAAGAGAGCCCAGGAAGGTGGG + Intronic
1065740479 10:28792538-28792560 AGAAAACAGCCCAGGACGGCTGG + Intergenic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1069624564 10:69859885-69859907 ACAAAACAGCCCTGAAAGGCTGG - Intronic
1069639440 10:69945361-69945383 AGAAAGCAGGGCAGGAAGGCAGG - Intronic
1070458746 10:76643883-76643905 GGAAAACAGGCCAGGCAGGCTGG - Intergenic
1071769823 10:88715810-88715832 AGAAAACAGGCAAGGAAGGAAGG - Intergenic
1072719602 10:97772228-97772250 AGGAAAATGCCCAGGGAGGCAGG - Intergenic
1073048965 10:100655921-100655943 AGAAAAGGGAAGAGGAAGGCTGG - Intergenic
1074875685 10:117611447-117611469 AGAAACTGACCCAGGAGGGCGGG - Intergenic
1076218819 10:128716817-128716839 TGAAAATGGCCCAGGACGGTGGG - Intergenic
1076588104 10:131563777-131563799 AGAGAAAGGCCGAGGAAGACTGG + Intergenic
1076651573 10:131992720-131992742 ATAAAAGAGCACAGGAAGGCCGG + Intergenic
1077408208 11:2391972-2391994 AGGACAAGGCCCAGGATGGCTGG - Intronic
1079029579 11:16976437-16976459 AGAAAACAGGCTAGAAAGGCTGG + Intronic
1081678047 11:44982438-44982460 AGAAAAAGGCTCTGGACGGCAGG - Intergenic
1081751307 11:45513177-45513199 AGGAAATAGCCCATGAAGGCAGG + Intergenic
1082989302 11:59193712-59193734 AGAAAAGGGCCCAAGAAGAAAGG + Intronic
1083800160 11:65041830-65041852 AGAAAGAGGCCCTGGAAGGCGGG - Exonic
1084575824 11:69987246-69987268 AGGAAGCCGCTCAGGAAGGCAGG - Intergenic
1087805720 11:102553045-102553067 AAAGGATGGCCCAGGAAGGCTGG - Intergenic
1088455888 11:110032794-110032816 AGAAAACCTCCCAGCAAGTCAGG - Intergenic
1088913340 11:114208651-114208673 AGAAAAGGGCCCAGAAAAGCTGG - Intronic
1089162020 11:116445616-116445638 AGACAACAGCCCAGACAGGCTGG - Intergenic
1089398632 11:118152123-118152145 GGAAAAGGGCCCAGGAAGAAGGG + Intronic
1090444151 11:126748964-126748986 CTAAGAAGGCCCAGGAAGGCTGG - Intronic
1091554247 12:1560295-1560317 AGAGAAGGCCCCAGGAAGGTTGG - Intronic
1092936086 12:13366010-13366032 AGAAAGCGGCCCAGATAGGCTGG - Intergenic
1096360292 12:50979482-50979504 ATAAAACCACCCAGGGAGGCGGG + Intronic
1096529903 12:52235966-52235988 AGAAGGAGGCTCAGGAAGGCTGG + Intronic
1096770584 12:53933720-53933742 AGAAAAGGGCTGAGGAAGGAGGG + Intergenic
1098039392 12:66338888-66338910 AGGAAAAGTCCCAGGTAGGCTGG - Exonic
1099878295 12:88436216-88436238 AGAAAGCTGGCAAGGAAGGCAGG - Intergenic
1101193773 12:102361788-102361810 AGAAAACGACGAAGGAAGGAAGG + Intergenic
1101201201 12:102438217-102438239 AGAAGACCGCAGAGGAAGGCAGG - Intronic
1101435129 12:104657996-104658018 GGAAAACTACCCAGGAAGGTGGG - Intronic
1104243739 12:127016962-127016984 AGAAAGAGGCCCAGGAAGTGGGG + Intergenic
1104855230 12:131898782-131898804 AGAAAACCGCCCAGGCATGGTGG - Intronic
1107069480 13:36255079-36255101 AGAAAACACCTCAGGAAAGCTGG - Intronic
1111671898 13:91341969-91341991 AGAAAATAGCCTAGGAAGGTGGG - Intergenic
1111986920 13:95075568-95075590 AGAAAACAGCTCAGTGAGGCTGG + Intronic
1116277585 14:42856230-42856252 AGAAAACAGCAGAGGAAGTCAGG + Intergenic
1117643282 14:57823222-57823244 AGAAAAGGGACTAGGAAGCCTGG - Intronic
1118371922 14:65144548-65144570 AGAACCTGGCCCAGTAAGGCAGG + Intergenic
1118841796 14:69519026-69519048 AGAGAAAGGCCCAGGAAGCCAGG + Intronic
1118902272 14:69996455-69996477 AGAATACAGCCCAAGAAGACAGG - Intronic
1119564920 14:75620305-75620327 GGAGAAAGGCCCAGGCAGGCAGG - Intronic
1121051346 14:90820766-90820788 AGCAAAAGCCCCAGGAGGGCAGG + Intergenic
1122067432 14:99183606-99183628 AGCGAACGACCCAGGAAGGCAGG - Intronic
1122288585 14:100667442-100667464 TCAAAATGGCCCAGGAGGGCTGG - Intergenic
1123701760 15:22919157-22919179 AGAAAAAGACTCAGGAAAGCAGG + Intronic
1124377788 15:29139735-29139757 GGAAAAGGGTCCAGGAAGGTGGG - Intronic
1124720419 15:32106766-32106788 AGAGAAGGACCCAGGAAGGCTGG - Intronic
1128609272 15:69060919-69060941 AGAAAACGCATCAGGATGGCTGG - Intronic
1128932334 15:71716727-71716749 GGAAAAAGGCCCTGGAAGTCGGG - Intronic
1129351658 15:74958955-74958977 AGAAAAAGCCCCCGAAAGGCTGG + Intronic
1130901811 15:88212919-88212941 AGAAACAGCCCCAGGAAAGCTGG + Intronic
1131045784 15:89314350-89314372 AGAAAATGGCTGAGGAGGGCAGG - Intronic
1132388674 15:101422013-101422035 AGAAAAGGGCAGAGGTAGGCAGG + Intronic
1132718676 16:1305162-1305184 AGAAAATGGCTCTGGAGGGCCGG - Intergenic
1133333236 16:4989234-4989256 TGAAAACGATCCAGCAAGGCAGG - Intronic
1137645612 16:50070753-50070775 AGAAAACGGACTGGGAAGGAGGG - Intronic
1138851287 16:60632862-60632884 AGCAAAGGGCTCAGGAAGGCTGG + Intergenic
1140058313 16:71545145-71545167 AGAAAACTAGCCAGGAAAGCAGG - Intronic
1142067501 16:88071296-88071318 TCAAGACGGCCCAGGCAGGCGGG - Intronic
1142123272 16:88397426-88397448 AGAAGACTGCTGAGGAAGGCTGG + Intergenic
1142150292 16:88509662-88509684 AGAAACAGGCCCAGGGAGGCGGG + Intronic
1142197071 16:88743910-88743932 GGAAAACCGTCCAGGAAGGGAGG + Intronic
1142671545 17:1489748-1489770 AGTAAACGGCCCAGGAGCGGTGG + Intronic
1142686715 17:1581379-1581401 AGAAAGCAGCCCAGGAGGCCAGG + Intronic
1143059417 17:4187399-4187421 AGAAAACTGCCTGGGATGGCTGG - Intronic
1143313998 17:6017555-6017577 CGAGGATGGCCCAGGAAGGCAGG + Intronic
1145056530 17:19707094-19707116 TGAAAACTCCCCAGGGAGGCAGG - Intronic
1145243975 17:21255756-21255778 AGAAAAAGACCCAGAAAGGGAGG + Intergenic
1145834407 17:27943391-27943413 AGAAAAGGGGCAAGGAAAGCAGG - Intergenic
1146890235 17:36502036-36502058 TGAAAACTGCCCAGGAGGGGAGG + Intronic
1147348315 17:39820127-39820149 AAAAAATAGCCCAAGAAGGCTGG + Intronic
1148232916 17:45948299-45948321 GGAAAAGAGCCCAGGAGGGCTGG - Intronic
1151683793 17:75635327-75635349 ACAAGACGCCCCAGGCAGGCAGG + Intronic
1151685661 17:75644981-75645003 AGAGAAAAGGCCAGGAAGGCCGG - Intronic
1152156225 17:78635156-78635178 AGAAAAAGACCCAGGTAGGCTGG + Intergenic
1153925719 18:9833166-9833188 AGAAAATGGCCCAGGAAGGCCGG + Intronic
1154999728 18:21674653-21674675 ATATAACAACCCAGGAAGGCTGG - Intronic
1157621035 18:49017617-49017639 ACAAAAAGGCCCAGTTAGGCCGG + Intergenic
1159194903 18:65100889-65100911 AGAGAATGGCCCAGGAAAACTGG + Intergenic
1159868729 18:73736305-73736327 AGAAAATGTCCCAAGAAGGAAGG + Intergenic
1159868927 18:73738842-73738864 AGAAAAGAGGGCAGGAAGGCAGG + Intergenic
1160055620 18:75477084-75477106 AGAAAGCAGCCCAAGAAGACAGG - Intergenic
1160949705 19:1659578-1659600 AGAAAACTGCCGACCAAGGCCGG - Intergenic
1161707123 19:5827443-5827465 GGAAAGCGGCCCAGAAAGGATGG + Intronic
1163389025 19:17018584-17018606 TGAAAACAGCCCAGGCAGGGTGG + Intronic
1163493537 19:17631234-17631256 AGAACAAGACCCAGGAAGGAAGG - Intronic
1166397617 19:42453524-42453546 AGAAAATGGACCAGTAGGGCTGG + Intergenic
1166413086 19:42569906-42569928 AGAAAATAGGCCAGGAGGGCTGG + Intergenic
1167691241 19:50984590-50984612 AGAAAATGGCCCCAGAAGCCGGG - Intergenic
1167724454 19:51200939-51200961 AGAGAACGTCCCAGGACGACCGG - Intergenic
1167758299 19:51426914-51426936 AGAGAACGTCCCAGGACGACCGG + Intergenic
1167971920 19:53193067-53193089 AGGAAACGGCGCAGGAAAGGAGG + Intronic
1168254621 19:55158590-55158612 AGAGAAAGGCCCAGGAGTGCTGG - Intronic
925714683 2:6773157-6773179 AGAAACCGGCCCCGGGCGGCAGG + Intergenic
926246678 2:11126687-11126709 AAAAAAAAGCCCAGGAAGGTAGG + Intergenic
927199421 2:20569102-20569124 GGAACAAGGCCCAGGCAGGCTGG - Intronic
927588881 2:24335628-24335650 AACAAACAGCCCTGGAAGGCTGG - Intronic
928080707 2:28309937-28309959 AGGAAAAGGCCCAGGAGGGACGG - Intronic
929597587 2:43186090-43186112 AGAAACAAACCCAGGAAGGCTGG - Intergenic
929906002 2:46047123-46047145 ATAAAAATGGCCAGGAAGGCTGG - Intronic
930550348 2:52826809-52826831 AGAAAAAGGCATAGGGAGGCAGG + Intergenic
930632106 2:53764909-53764931 AGAAAAAGCATCAGGAAGGCAGG + Intronic
930832593 2:55761034-55761056 AGAAAAGGGCATAGGAAGACAGG - Intergenic
930878728 2:56248445-56248467 AGAAGACAGCACAGGAAGGGAGG - Intronic
931439914 2:62281764-62281786 AGAAGGTGGCTCAGGAAGGCTGG + Intergenic
931474120 2:62570687-62570709 CAACAACAGCCCAGGAAGGCTGG - Intergenic
932186314 2:69699242-69699264 AGAAAAGAGCCCTGGAAGGTGGG - Intronic
932576686 2:72966129-72966151 AGAAAGCTGCCCAGGGAGGATGG - Intronic
932833402 2:75011886-75011908 ATAAAAATGCCCATGAAGGCCGG + Intergenic
933608143 2:84405899-84405921 AGAAAATGTTCCAGGGAGGCTGG + Intergenic
936433673 2:112484696-112484718 AGGTAAAGGCTCAGGAAGGCAGG + Intronic
936671572 2:114662599-114662621 AGAACACGGTCCAGGGAGGCTGG + Intronic
938849157 2:135242622-135242644 AGAAAACTTCCCAGGACGGAAGG - Intronic
940204960 2:151192710-151192732 AGAAAGCTGCCCAGGCAGGATGG + Intergenic
940760339 2:157731836-157731858 AGAAAATAGCCCAGGATTGCTGG + Intergenic
941298728 2:163774055-163774077 AGAGAAAGACCCAGGAAGGAAGG - Intergenic
941922768 2:170868471-170868493 AGAAAAAGGCCCAGGCATGGTGG - Intergenic
942438768 2:176009448-176009470 AAAAAATGGCCAAGGAATGCAGG + Intergenic
943685768 2:190816386-190816408 AGAAAACAGGGCAGGAAGACAGG - Intergenic
944793719 2:203161029-203161051 AGAAAATAGGCCAGGGAGGCTGG + Intronic
944929488 2:204501695-204501717 AGAGAAGGGGTCAGGAAGGCTGG - Intergenic
946306422 2:218859384-218859406 AGAAAACTTCCCAGGAATGAGGG - Intergenic
946759613 2:222980363-222980385 GAAAAACTGCACAGGAAGGCAGG + Intergenic
948261508 2:236607437-236607459 AGAAAAGGGCCCAGGAAGCCAGG - Intergenic
948754418 2:240150702-240150724 GGAAAACGGCCTGGGAAGGCTGG - Intergenic
1169745046 20:8935080-8935102 AGAAAACGGCCCAGGAAGGCTGG - Intronic
1171115827 20:22524098-22524120 AGAGGACGGCACAGGAGGGCTGG - Intergenic
1171192261 20:23166886-23166908 AGAAAAGGGCCAAGGAGGGAAGG + Intergenic
1175126084 20:56752405-56752427 GGAAAACAGCCCAGGGAGGGAGG + Intergenic
1176139911 20:63540435-63540457 AGACAACGGCACAGGAGGGTGGG - Intergenic
1176667242 21:9699001-9699023 GGAAAACATCCAAGGAAGGCCGG + Intergenic
1179226635 21:39459508-39459530 AGAAAAAGGCCCAGGCATGGCGG - Intronic
1180742772 22:18065290-18065312 AGAAATGAGGCCAGGAAGGCAGG + Intergenic
1180746405 22:18092087-18092109 AGAGGACGGCACAGGGAGGCTGG - Exonic
1181316726 22:21975335-21975357 AGAAACCAGCCCTGGAAGGAAGG - Intronic
1181384108 22:22531162-22531184 ATAAAATGGCCTAGGATGGCCGG + Intergenic
1181601587 22:23955397-23955419 TGGAAAAGGCCCAGGAAAGCAGG + Intergenic
1181606913 22:23985901-23985923 TGGAAAAGGCCCAGGAAAGCAGG - Intergenic
1181897093 22:26119985-26120007 TGAAAACAGCCCAGGATGACTGG - Intergenic
1184294664 22:43515816-43515838 AGAACCTGACCCAGGAAGGCAGG + Intergenic
1184366330 22:44053947-44053969 CATAAAAGGCCCAGGAAGGCAGG - Intronic
1184566801 22:45296945-45296967 ATACAACAGCCCAGGCAGGCTGG + Intergenic
1184668859 22:46002385-46002407 AGAAAACTGCCCTGGTGGGCTGG + Intergenic
1185147247 22:49145313-49145335 AGAAAACAGCCCTGTGAGGCTGG - Intergenic
1185288547 22:50013074-50013096 AGACAAGGGCCCTGGAAAGCTGG + Intergenic
950024479 3:9810759-9810781 AGAAAACAGCGCAGGGAGACAGG - Intronic
954437202 3:50502735-50502757 AGGAAAAGGCCCTTGAAGGCAGG + Intronic
955320116 3:57968378-57968400 AGAAAAAGGCCCAAGAGGACTGG + Intergenic
955600036 3:60635430-60635452 AGAAAACGGCTTATGAAGGAGGG - Intronic
955738117 3:62061227-62061249 AGAAGTCTGCCCAGGAAGTCTGG - Intronic
955870890 3:63437160-63437182 AGAAAACGGGCCAGGCACGGTGG - Intronic
959608279 3:108265991-108266013 AGAAAACGGGCCAGGCACGGTGG + Intergenic
966207526 3:177420266-177420288 AGAATATGCCCCAGGAAGGTGGG - Intergenic
966458558 3:180146900-180146922 AGAAAATGCACAAGGAAGGCTGG - Intergenic
967845587 3:194040181-194040203 AGAAACAGGCCCAGGAAAGAGGG - Intergenic
968325061 3:197806580-197806602 AGAAAAGGGCATAGGAATGCCGG + Intronic
970222202 4:13822735-13822757 TGAATACGTTCCAGGAAGGCAGG - Intergenic
970477818 4:16441523-16441545 AGGAAAAGGCTCAGGAAGGAAGG + Intergenic
971753075 4:30676207-30676229 AGAAAGCTGCCCAGGAAGGATGG - Intergenic
972571735 4:40317482-40317504 AGAACGCGGGACAGGAAGGCAGG + Intergenic
973295729 4:48518635-48518657 AGAAAACTGGCCAGTAAGGCTGG - Intronic
973733749 4:53849692-53849714 AGAAAATGGGCCAGGAATGGTGG + Intronic
973828457 4:54733915-54733937 AGAAATGGGCCCAGGAAGACAGG - Intronic
976422457 4:84861890-84861912 ACAAAAGGAACCAGGAAGGCTGG + Intronic
977453267 4:97225556-97225578 ATAAAACGGCCTAAGAAGGCAGG - Intronic
978183640 4:105832957-105832979 TGAAAACAGCCTAGGAAGGCTGG - Intronic
981116211 4:140993901-140993923 AAAACACTGCCCAGGAAGGATGG + Intronic
981396398 4:144254750-144254772 AGAAAACAGCCAATGATGGCAGG - Intergenic
982092588 4:151893185-151893207 TGAAAAAGGCAAAGGAAGGCAGG - Intergenic
984474094 4:180215375-180215397 AGAAAATGGCCCAGGAAGGCTGG - Intergenic
984809402 4:183781610-183781632 GGAGAAAGGCCCAGGCAGGCTGG - Intergenic
984925543 4:184803284-184803306 AGAAAACGCACGAGGCAGGCTGG + Intronic
985407766 4:189653333-189653355 GGAAAACATCCAAGGAAGGCTGG - Intergenic
986520776 5:8615643-8615665 AGAAAACGTCACAGAAAGGTTGG + Intergenic
986637860 5:9841704-9841726 GGAAAATGGCCCAGGTAGACTGG - Intergenic
988563111 5:32298533-32298555 AGAAAACTGTGCAGGAAGGGAGG + Intronic
989452039 5:41597793-41597815 AGTAAAAGGCAGAGGAAGGCTGG - Intergenic
990338786 5:54801865-54801887 AGGAAACGGCCCTGCATGGCAGG + Intergenic
991998955 5:72417182-72417204 AGGTAAAGGCCCAGGAAAGCAGG - Intergenic
993379197 5:87186640-87186662 AGAGAAGGGCCAAGGAAGCCTGG - Intergenic
998066446 5:139163110-139163132 ATAAAGCTGCCAAGGAAGGCAGG + Intronic
998234449 5:140386143-140386165 AGAAAATGGCAGAGGAAGCCGGG - Intergenic
1001219250 5:169885006-169885028 AGAAAAGGGTCCAGGCAGACAGG - Intronic
1001772267 5:174305358-174305380 GGAAATGGGCCCAGTAAGGCAGG + Intergenic
1003114109 6:3271967-3271989 GGAAGCTGGCCCAGGAAGGCAGG + Exonic
1003826249 6:9955607-9955629 AGAAAATGGACCGGGAAGGGAGG - Intronic
1004380978 6:15132175-15132197 AGAAAAAGGCACAAGGAGGCGGG - Intergenic
1005588243 6:27298065-27298087 AGAAAACGGTCGACGAAGGTGGG - Intronic
1007788273 6:44294446-44294468 AGAAAAGGGGCAAGGGAGGCGGG + Intronic
1008385111 6:50880337-50880359 AGAAAAGGGGACAGGAAGGGAGG - Intergenic
1008889050 6:56464134-56464156 AGAAGACAGACCAGTAAGGCAGG + Intronic
1011658884 6:89577049-89577071 ATAAAGATGCCCAGGAAGGCTGG - Intronic
1013793670 6:113860377-113860399 AGAAAAAGGCCGAGGAGGCCGGG + Exonic
1018012688 6:159686033-159686055 AGAAAACTGCCCATCAAGACAGG - Intronic
1018647716 6:165963629-165963651 AGAAAAGGGCCCAGAGAGGGTGG + Intronic
1019064973 6:169288886-169288908 AGAAGAAGGCCTAGGCAGGCAGG - Intergenic
1019188836 6:170238330-170238352 TGGAAAGGGCCCAGGAGGGCAGG + Intergenic
1019479959 7:1261750-1261772 AGAAAATGGCCCTTGCAGGCTGG - Intergenic
1020040844 7:4999678-4999700 AGAAAAGAGCCCTGGAAGGTGGG - Intronic
1022107291 7:27205532-27205554 AGAAAGCGGCGCAGGCAGCCAGG + Intergenic
1022176193 7:27874141-27874163 AGGTCACTGCCCAGGAAGGCTGG + Intronic
1024333501 7:48179951-48179973 AGAAAATGAGCCAGGAAGGGTGG + Intronic
1025966767 7:66280242-66280264 AGAAAACAGCCCAAGAATGCTGG - Intronic
1029461711 7:100698204-100698226 AGAAAAAGGGCCAGGAACGGTGG - Intergenic
1030230258 7:107200792-107200814 AGAAATAGGCCCAGGAATGGTGG + Intronic
1031748421 7:125536708-125536730 AGAAACCGACTCAGGAAAGCAGG - Intergenic
1032097982 7:128948981-128949003 AGAGAAAGGCCCGGGAAGGCAGG - Intronic
1032383884 7:131508252-131508274 AGAAAAGGGCCCAGGAATGCAGG - Intronic
1032856783 7:135841576-135841598 AGAAAACAGACCAGGAGTGCTGG - Intergenic
1033144197 7:138856946-138856968 AGAAAAAGACAGAGGAAGGCTGG + Intronic
1033528832 7:142243549-142243571 AGAAAGAGGCTCAGGAAAGCTGG + Intergenic
1033616643 7:143022944-143022966 AGAACACTGTCCAGGAATGCAGG - Intergenic
1035020974 7:155800291-155800313 AGAAGATGGACCAGGAGGGCTGG + Exonic
1035299224 7:157886353-157886375 AGAAAAGGGCACAGGGAGGGAGG + Intronic
1035901997 8:3466714-3466736 AGAAAACAGCCCGGGCAGGGGGG - Intronic
1037451080 8:19015481-19015503 ACAAAACCGTCAAGGAAGGCAGG - Intronic
1038413414 8:27375669-27375691 AGAACACGGCCCCCGGAGGCAGG - Intronic
1039844548 8:41316605-41316627 AGAAAATGTCCCAGGAAGGCTGG + Intergenic
1040526459 8:48229465-48229487 AGAAACAGGGCCAGGCAGGCAGG - Intergenic
1044217562 8:89629926-89629948 AGAAAAGGGCTGAGGAAAGCAGG - Intergenic
1046734807 8:117765779-117765801 GGAAAATGGCCCAGGAAGAAGGG + Intergenic
1047184671 8:122622000-122622022 ACAAAAAGGCAGAGGAAGGCTGG + Intergenic
1047268713 8:123333539-123333561 AGAAGTCTGCCAAGGAAGGCAGG + Intronic
1048850137 8:138637028-138637050 AGGAAAGGGGCCAGGGAGGCAGG + Intronic
1048888237 8:138925563-138925585 AGAAAAAGGTCCAGGAGGGCAGG + Intergenic
1048967752 8:139626547-139626569 AGAAAGAGGCCCAGGGAGGGAGG - Intronic
1054769474 9:69070246-69070268 AGAAAACGGCCCAGGAAGGCTGG + Intronic
1055028112 9:71744076-71744098 AGAATATGGCACAAGAAGGCTGG + Intronic
1055700039 9:78934134-78934156 AGAAAAAGTCTCAGGAAGGAAGG + Intergenic
1056309236 9:85322510-85322532 AGAAAATGGCCCAGAAAGGCTGG + Intergenic
1056602029 9:88053971-88053993 AGGAACCAGCCCAGGCAGGCAGG + Intergenic
1056637621 9:88344695-88344717 AGAAAACAGCCAAGGCAGGAAGG + Intergenic
1056899569 9:90585149-90585171 AGAAAAGGGCCCAGGAAGGATGG + Intergenic
1057250069 9:93493912-93493934 AGAAAAGGGCCCAGGAAGGCTGG - Intronic
1057479019 9:95429523-95429545 AGAAAAGACCCGAGGAAGGCAGG + Intergenic
1062468341 9:136691335-136691357 AGGAGACGGCCCAGGGAGGAGGG + Intergenic
1062583625 9:137239005-137239027 ACAGATCAGCCCAGGAAGGCGGG - Intergenic
1203658855 Un_KI270753v1:22759-22781 GGAAAACATCCAAGGAAGGCCGG - Intergenic
1185474444 X:406079-406101 AGAATACAGTCCAGGAAGGAAGG - Intergenic
1186438796 X:9567173-9567195 AGAAAATGGCACAGAGAGGCAGG + Intronic
1186612135 X:11148052-11148074 AGAAATGGGCCCAGGAGGGGAGG + Intronic
1189473960 X:41334772-41334794 AGAACGCGGCCCAGGAATGTGGG + Intronic
1193397567 X:81003782-81003804 GGAAAGCGGCCCAGGGACGCAGG - Intergenic
1194025705 X:88747253-88747275 AGAAAAGGGGTCAAGAAGGCAGG + Exonic
1195035388 X:100967302-100967324 AGAAAACAGGCCAGGAGGCCGGG + Intergenic
1196188163 X:112766468-112766490 AGAAAAAGGCCGAAGAAAGCAGG - Intergenic
1196335907 X:114534042-114534064 AGAGAAGGGGCCAGCAAGGCTGG - Intergenic
1196412594 X:115435626-115435648 AGAAAACGTTCATGGAAGGCAGG - Intergenic
1196735523 X:118977972-118977994 AGAAAACAGGCCAGGTAGGAAGG - Intronic
1196828774 X:119760120-119760142 AGAAAAAGTACCAGTAAGGCTGG - Exonic
1199982775 X:152929859-152929881 AGAGAAAGGCCCAGGGAGGGAGG - Intronic
1200749784 Y:6934295-6934317 AGAAAAAGGCCCAGCCAGGCAGG - Intronic
1202338547 Y:23835690-23835712 ATAAAGAGGCCCAGGAAGGGAGG + Intergenic
1202532219 Y:25834382-25834404 ATAAAGAGGCCCAGGAAGGGAGG - Intergenic