ID: 1054775785

View in Genome Browser
Species Human (GRCh38)
Location 9:69122276-69122298
Sequence ACGCGGGCGGAGCGCGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054775780_1054775785 -7 Left 1054775780 9:69122260-69122282 CCGGTGCCTTGGAGTGACGCGGG No data
Right 1054775785 9:69122276-69122298 ACGCGGGCGGAGCGCGGCGCTGG No data
1054775775_1054775785 19 Left 1054775775 9:69122234-69122256 CCAACTGCATCGGGTGGGGGCAG No data
Right 1054775785 9:69122276-69122298 ACGCGGGCGGAGCGCGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054775785 Original CRISPR ACGCGGGCGGAGCGCGGCGC TGG Intronic