ID: 1054779991

View in Genome Browser
Species Human (GRCh38)
Location 9:69157134-69157156
Sequence GGCCCCTGCAACCATCTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 9, 2: 29, 3: 62, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054779991_1054779992 -4 Left 1054779991 9:69157134-69157156 CCATTCAGATGGTTGCAGGGGCC 0: 1
1: 9
2: 29
3: 62
4: 248
Right 1054779992 9:69157153-69157175 GGCCCTTCAAATTTTATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054779991 Original CRISPR GGCCCCTGCAACCATCTGAA TGG (reversed) Intronic
900712260 1:4121913-4121935 GGACCGTGCAACCCTCAGAAGGG - Intergenic
900721090 1:4176236-4176258 AGGCCCCTCAACCATCTGAATGG + Intergenic
900847160 1:5113126-5113148 CCCCTCTGCAGCCATCTGAATGG - Intergenic
901777774 1:11572253-11572275 GCCACCTGCATCCAGCTGAATGG - Intergenic
901936351 1:12629793-12629815 GGCCTCTGCACCCTTCTGAAAGG - Intergenic
902453949 1:16518297-16518319 AGGCCCTACAACCAACTGAATGG + Intergenic
904941840 1:34169218-34169240 GGACCCTGGAAACATCTGCAGGG + Intronic
905004153 1:34696872-34696894 GGCCACTGCGACCAACTCAAAGG + Intergenic
905411017 1:37767948-37767970 GGCCCCTCCACCCTTCTGCAAGG - Intergenic
906632031 1:47379493-47379515 CGCCCCCACAACCATCTGAATGG - Intergenic
911022275 1:93400837-93400859 CCTCCCTTCAACCATCTGAATGG + Intergenic
911264536 1:95727377-95727399 GCCCCCTGCAACCATCTGAATGG - Intergenic
914098513 1:144564536-144564558 AGGCCCTACAACCAACTGAACGG + Intergenic
914300470 1:146373106-146373128 AGGCCCTACAACCAACTGAACGG - Intergenic
915590960 1:156869980-156870002 GGCCCCTGGAACCATGTTGAGGG + Intronic
915662036 1:157412623-157412645 GGAACCTGCATTCATCTGAAGGG + Intergenic
916801376 1:168219704-168219726 AGGCCCTCCAACCATCAGAATGG - Intergenic
918626568 1:186662361-186662383 AGCCCCTGAAACCTTCTAAAAGG + Intergenic
919065636 1:192689865-192689887 GGCCCCCGCAACTATCTGAATGG + Intergenic
919600826 1:199620337-199620359 GGACCCTGCAGACATCTGAGAGG - Intergenic
920311691 1:205052493-205052515 GGCCCCTTCACCCATCTGGTTGG + Intronic
920334805 1:205237834-205237856 CTCCCCTGGAACTATCTGAAAGG - Intronic
920363915 1:205438207-205438229 GGCCCCCTCACCCATCTGCAAGG + Intronic
922152735 1:223019297-223019319 GGCCCCACCAACTATCTGAATGG + Intergenic
922166424 1:223119144-223119166 AGGCCCCACAACCATCTGAATGG - Intronic
922609701 1:226916765-226916787 AGGCCCTGCAACCATCTGAAAGG + Intronic
922694423 1:227721329-227721351 GCCTCCCCCAACCATCTGAATGG + Intergenic
922703719 1:227777810-227777832 GGGCCCTGCCACCATCTGTAAGG + Intronic
923755867 1:236790796-236790818 AGGCCCCTCAACCATCTGAATGG + Intergenic
1068419543 10:56771986-56772008 CCCCCCCGCAACCATCTGAATGG - Intergenic
1070459398 10:76649558-76649580 GTCACCTGCATCCATCTGCAAGG - Intergenic
1071361650 10:84852080-84852102 GGCCCCTGCAGCCCTCAGACAGG + Intergenic
1072357668 10:94627607-94627629 AGTCCCCCCAACCATCTGAATGG + Intergenic
1074002082 10:109383601-109383623 GGCCCCCCAAACCATCTGAATGG + Intergenic
1075107481 10:119550731-119550753 AGCCACTGCACCCAGCTGAAAGG + Intergenic
1075350105 10:121716327-121716349 AGGCCCCTCAACCATCTGAATGG - Intergenic
1076347028 10:129786097-129786119 GGCACCTGCAGCCACCTGTAGGG + Intergenic
1076378707 10:130010567-130010589 AAGCCCTACAACCATCTGAATGG - Intergenic
1076984625 11:226376-226398 AAGCCCTGCAACCAACTGAATGG - Intronic
1077101936 11:826259-826281 GGCCCCTGCACCCACCTGAAGGG - Intronic
1077763841 11:5135446-5135468 AGTCCCTTCAACCATTTGAATGG + Intergenic
1078078981 11:8190344-8190366 GCTGCCTGAAACCATCTGAAGGG + Intergenic
1078079038 11:8190859-8190881 GCTGCCTGAAACCATCTGAAGGG - Intergenic
1078515238 11:12016442-12016464 GGTCCCTGCAGCCATCTTCAGGG + Intergenic
1079074495 11:17375564-17375586 TGCCCATGCTGCCATCTGAAAGG + Exonic
1079163685 11:18016825-18016847 GCCCCCCCCAACCATCTGAATGG + Intergenic
1080045301 11:27801553-27801575 AGACCCCCCAACCATCTGAATGG - Intergenic
1081505452 11:43711923-43711945 GCCCCCTGCAGCCATCTGAATGG + Intronic
1082095019 11:48122832-48122854 GGCCCCTGCAGCCCTCAGGAGGG + Intronic
1083421738 11:62557061-62557083 GGCCCCAGCAACAAGCTAAAAGG + Intergenic
1083951592 11:65959541-65959563 GGACTCTGCAACCATCTGAGCGG + Intronic
1084046424 11:66570875-66570897 ATCCCCTCCAACCATCTGAATGG + Intergenic
1084628939 11:70332867-70332889 GAGCCCTAAAACCATCTGAATGG - Intronic
1085151757 11:74257927-74257949 GGCCCCTGCATCCAACTTAAGGG - Intronic
1087175179 11:95089709-95089731 GGCCTCTGCAGCCATCTTCAGGG + Intergenic
1088877685 11:113949516-113949538 GGGCCCCCCAACCATCTGAATGG + Intergenic
1089470275 11:118715137-118715159 GGCCCCCCTAATCATCTGAATGG - Intergenic
1090096982 11:123752025-123752047 GGGCCTCTCAACCATCTGAATGG - Intergenic
1090887028 11:130886529-130886551 GGCCCCTGCAAACATTTTACAGG - Intronic
1091257074 11:134198044-134198066 AGGCTCTCCAACCATCTGAATGG + Intronic
1091466348 12:688137-688159 GCCCCCTCCAACCATCTGAATGG - Intergenic
1092592066 12:9961341-9961363 AGGCCCCTCAACCATCTGAATGG - Intronic
1092594362 12:9985275-9985297 GCCCCCCACAACTATCTGAATGG - Exonic
1092725955 12:11485757-11485779 GCCCCTGGCAACGATCTGAATGG + Intronic
1094385226 12:29886439-29886461 AGGCCCCCCAACCATCTGAATGG - Intergenic
1094589404 12:31806502-31806524 AGGCCCCCCAACCATCTGAATGG + Intergenic
1094629316 12:32157612-32157634 GGCCCCTGCAACCACCCAACAGG - Intronic
1097144970 12:56933814-56933836 GGCCCCTGCCTCAATCTGATTGG - Intronic
1097517683 12:60625344-60625366 AGCTCCCCCAACCATCTGAATGG - Intergenic
1097931327 12:65190228-65190250 GCCCCCTGCAACCATCTGAATGG + Intronic
1101517137 12:105447108-105447130 GCCCCCCCCAACCATCTGAATGG + Intergenic
1103049730 12:117768630-117768652 GGCTCCTGGAAGCATCTGGATGG + Intronic
1104277277 12:127341319-127341341 AGGCCCTGAAATCATCTGAATGG + Intergenic
1104304220 12:127594681-127594703 TCCCCCCTCAACCATCTGAATGG - Intergenic
1104436432 12:128760560-128760582 GGCGGCTGCAATCCTCTGAAGGG - Intergenic
1106123067 13:26877923-26877945 GCCTCCCGCAACCACCTGAATGG - Intergenic
1106128447 13:26920377-26920399 GGCCCCTGGAGCCATCTGGGTGG + Intergenic
1107079121 13:36355677-36355699 GCTCCCCCCAACCATCTGAATGG + Intronic
1108960228 13:56217570-56217592 GGCATGTGCAAACATCTGAAAGG - Intergenic
1110434652 13:75465593-75465615 AGCCCCTACAACCATGTGAATGG + Intronic
1110928368 13:81184547-81184569 AGCTCCCCCAACCATCTGAATGG + Intergenic
1111480282 13:88815076-88815098 AGCCCCCACAACCATCTGAATGG - Intergenic
1111937626 13:94572897-94572919 GTCCCATACAACCAACTGAAAGG + Intergenic
1113828514 13:113275648-113275670 GCCCCCTCAGACCATCTGAATGG - Intergenic
1114387533 14:22270401-22270423 GCCCCCCGCAACCATCTGAGTGG - Intergenic
1114521887 14:23344686-23344708 CCACCCTGCAACCATCTGAATGG + Intergenic
1115617762 14:35112588-35112610 AGGCCCCCCAACCATCTGAATGG + Intronic
1118264184 14:64278810-64278832 AGGCCCCTCAACCATCTGAATGG + Intronic
1118474007 14:66100439-66100461 GAACGCTGCCACCATCTGAATGG + Intergenic
1118997197 14:70847242-70847264 AGCCACTGCACCCAGCTGAAAGG + Intergenic
1120622304 14:86778851-86778873 AGGCCCCCCAACCATCTGAATGG - Intergenic
1121163071 14:91763127-91763149 CCCCCCCTCAACCATCTGAATGG - Intronic
1121428204 14:93868452-93868474 AAGCCCTGCAACCAACTGAATGG + Intergenic
1121663379 14:95652857-95652879 CCTCCCTGCAACCATCTGAATGG + Intergenic
1122050411 14:99055561-99055583 GGCCCCTTTCAGCATCTGAAAGG + Intergenic
1124603395 15:31152476-31152498 AGCACCCCCAACCATCTGAATGG + Intronic
1124821964 15:33054971-33054993 AACCCCTGCAACCATCTGAATGG + Intronic
1125445760 15:39754279-39754301 AGCCCCGGCAACCATTTGACAGG + Intronic
1126129655 15:45327915-45327937 AGCCCCCTCAACCATCTGAATGG + Intergenic
1127398374 15:58561931-58561953 AAGCCCTCCAACCATCTGAATGG - Intronic
1127946989 15:63765358-63765380 GCCCCCAGCAACCATCTGAATGG + Intronic
1128601649 15:69000108-69000130 GGCTCCTCCAACCATCTGAATGG - Intronic
1129367769 15:75067364-75067386 TGGCCCTGCAAACAGCTGAATGG + Intronic
1129748086 15:78038885-78038907 GGCCCCTGGGAGCATGTGAATGG + Intronic
1131825972 15:96322744-96322766 GGCCCCTGCAACCAGCTAAGGGG + Intergenic
1133000043 16:2845710-2845732 AGGCCCTCCAACCATCTGAATGG + Intergenic
1133165928 16:3947159-3947181 GTCCTCTGCAGCTATCTGAAGGG + Intergenic
1133715320 16:8441619-8441641 GGACCCTCCAACTTTCTGAAAGG - Intergenic
1134104787 16:11477751-11477773 GGCCTCTGCAGCCCTCTGTAGGG + Intronic
1134592694 16:15468603-15468625 AGGCCCCCCAACCATCTGAATGG - Intronic
1135042115 16:19125611-19125633 GGCCACTGCTACCATGTGAACGG + Intronic
1135256553 16:20946013-20946035 AGACCCTCCAACCATCTGAATGG + Intronic
1138205124 16:55119018-55119040 GGCCCATGCCACCACATGAAGGG + Intergenic
1139037511 16:62965591-62965613 GGCCACTGCATCAATCTGGAGGG + Intergenic
1139277306 16:65740074-65740096 TGCCCCTGCCACAATCTGTAGGG - Intergenic
1139302523 16:65957528-65957550 CCCCCCGCCAACCATCTGAATGG - Intergenic
1140056248 16:71528292-71528314 AGGCCCCCCAACCATCTGAAAGG - Intronic
1140500642 16:75430969-75430991 GGCGCCCCCAACCATCTGAATGG - Intronic
1140665926 16:77227529-77227551 AGCCCCTTCCTCCATCTGAATGG - Intergenic
1141177039 16:81727803-81727825 AGGCCCTGCAACCTTCTGAATGG + Intergenic
1141536877 16:84687747-84687769 GGCCCCAGAGAACATCTGAATGG - Intergenic
1142115084 16:88352257-88352279 CACCGCTGCCACCATCTGAAAGG - Intergenic
1143822111 17:9573089-9573111 CACCCCCGCAACCATCTGAACGG + Intronic
1145012252 17:19376263-19376285 GCCCTTTGCAACCATCTGAATGG + Intronic
1148942577 17:51227662-51227684 AGCCACTGCACCCAGCTGAAAGG - Intronic
1149169321 17:53791597-53791619 GGCCCCTGCCACCATCATTAGGG - Intergenic
1150136165 17:62696501-62696523 GGCTCCTGCATCTCTCTGAAGGG + Intergenic
1150294859 17:64002188-64002210 GGCCCCTCCAGCCACCTCAAAGG - Exonic
1150566917 17:66350090-66350112 GACCCCTGCCAGCACCTGAAAGG - Intronic
1150598219 17:66626117-66626139 GGCTCTTGCAACCAACTTAAAGG - Intronic
1150829861 17:68509881-68509903 GGCGCCTGCATGCAGCTGAATGG + Intergenic
1151874352 17:76858186-76858208 GATCCCCCCAACCATCTGAATGG + Intergenic
1151935093 17:77256613-77256635 TGCCCCTGGAGCCTTCTGAAGGG + Intergenic
1152014204 17:77739083-77739105 AGCCACTGCCACCATGTGAAGGG - Intergenic
1153704839 18:7734963-7734985 AAGCCCTGCAACCAACTGAATGG + Intronic
1153786075 18:8536820-8536842 GGCCCCTGCTAACTACTGAAGGG + Intergenic
1153848408 18:9070308-9070330 GGCTCCTGCAACTATTTAAATGG + Intergenic
1159355393 18:67333232-67333254 AAGCCCTGCAACCATCTGAATGG - Intergenic
1160365692 18:78324251-78324273 GGCCTCTGCACCCATCTGTGTGG + Intergenic
1163088150 19:14998087-14998109 TGCCCTACCAACCATCTGAATGG + Intronic
1164575650 19:29403976-29403998 GCCTCCTGCCACCAGCTGAAAGG - Intergenic
1164889635 19:31812299-31812321 GGCCCCCCCAACCATCTAAATGG - Intergenic
1165916238 19:39262627-39262649 GCCCCCCGCAACCATCTGAATGG + Intergenic
926507127 2:13731143-13731165 AGCCCCTGCAACCATCTGAATGG + Intergenic
927164219 2:20300489-20300511 GCCCCCAGCAACCATCTGAATGG - Intronic
927469149 2:23359333-23359355 AGCCCCTACAACTATCTAAAGGG + Intergenic
927746208 2:25623878-25623900 GCCCCCTGCAACCATCTGAGTGG + Intronic
927748672 2:25646027-25646049 AGGCCCCCCAACCATCTGAATGG + Intronic
928235055 2:29531989-29532011 GGCACCTGCAGCCCTCTGGAAGG - Exonic
928682022 2:33712628-33712650 GGCCCCCCCAACCATCTGAATGG + Intergenic
928930313 2:36617236-36617258 AGCCCCCCCAACCATCTGAATGG - Intronic
931415862 2:62079622-62079644 CACCTCTCCAACCATCTGAATGG - Intronic
932078525 2:68689558-68689580 AGGCCCCCCAACCATCTGAATGG - Intronic
933328049 2:80863578-80863600 GGCAGCTGCAGCCATCTGACAGG + Intergenic
933527779 2:83465545-83465567 CCCCCCCACAACCATCTGAATGG + Intergenic
933939100 2:87230804-87230826 TGCCCCTGCAACCATCTGAAAGG - Intergenic
936354034 2:111734971-111734993 TGCCCCTGCAACCATCTGAAAGG + Intergenic
936481173 2:112886260-112886282 AGCCCCCCCAACCATCTGAATGG + Intergenic
936562065 2:113548501-113548523 AGGCCCCTCAACCATCTGAATGG - Intergenic
937651795 2:124327368-124327390 TCCCCCTACAGCCATCTGAAAGG + Intronic
941863651 2:170310991-170311013 AGGCCCCGCAACCATCTGAATGG - Intronic
941928590 2:170919212-170919234 AACCCCTGCAACCATCTGAATGG - Intergenic
942172752 2:173303720-173303742 AGGCCCCCCAACCATCTGAATGG - Intergenic
943309227 2:186306469-186306491 GCCCACCCCAACCATCTGAATGG + Intergenic
943750237 2:191502932-191502954 AGTCCCCCCAACCATCTGAATGG - Intergenic
945980546 2:216307117-216307139 GGCCCCAGGAACCACCTGGAAGG + Intronic
947226887 2:227849272-227849294 GGCCCCGCCAACCATCTGAATGG + Intergenic
947949701 2:234136499-234136521 GAGCCCTTCAACCATCTAAATGG + Intergenic
948882645 2:240868264-240868286 CCCCCCAGCAACCATCTGAATGG - Intergenic
1169953015 20:11068195-11068217 AGACCCTGCAAACATATGAAAGG - Intergenic
1171432568 20:25092450-25092472 CTTCCTTGCAACCATCTGAATGG - Intergenic
1171974467 20:31585606-31585628 GGGGCCCCCAACCATCTGAACGG + Intergenic
1172177283 20:32980124-32980146 GGCCCTTGCCACCATCTGTATGG + Intergenic
1172183962 20:33020059-33020081 GGCCCCTGCCACTCTCTGAAAGG + Intronic
1175734307 20:61374608-61374630 GCACCCCCCAACCATCTGAACGG + Intronic
1175771199 20:61625677-61625699 GGAGGCTGCAAGCATCTGAACGG - Intronic
1175894141 20:62328659-62328681 GGTCCCTGAAACCTTCTGCATGG + Intronic
1177176300 21:17704055-17704077 AGCGCCTCCAACCATCTGAATGG + Intergenic
1177491205 21:21828459-21828481 AGGCCCTTCAACCATCTGAATGG - Intergenic
1178179619 21:30144853-30144875 GGACCCTCCAACCATCTGAATGG + Intergenic
1178897407 21:36570466-36570488 GTACCCCTCAACCATCTGAATGG - Intronic
1179261467 21:39761951-39761973 AGCCACTGCATCCAGCTGAAAGG + Intronic
1179659322 21:42864455-42864477 GGCCCCTCCATCCCTCTGCAGGG - Intronic
1179782890 21:43713782-43713804 AGGCCCCCCAACCATCTGAATGG + Intergenic
1180220544 21:46355594-46355616 GGCGTCTGGAACCCTCTGAAGGG + Exonic
1181165983 22:20983175-20983197 GGCACCAGCTAGCATCTGAAAGG - Intronic
1183113115 22:35667877-35667899 GGCCCCCTCAACCATCTAAATGG + Exonic
1183113956 22:35675292-35675314 CACCCCAACAACCATCTGAATGG + Intergenic
1184586075 22:45448941-45448963 GGCCCCTGGAACCTCCTGAGGGG + Intergenic
951054627 3:18133375-18133397 GGCCTCTGCAACTATGTAAATGG + Intronic
952234805 3:31468109-31468131 GGCTCCTGCCACCAGTTGAAGGG + Intergenic
954961732 3:54571430-54571452 ACCCCCCCCAACCATCTGAATGG - Intronic
961348943 3:126286863-126286885 GCTCCCCCCAACCATCTGAATGG - Intergenic
961800602 3:129445944-129445966 AGGCCCCCCAACCATCTGAATGG + Intronic
961800863 3:129447952-129447974 AGCCCCCCCAACCGTCTGAATGG - Intronic
962739516 3:138352826-138352848 GGCCTCTGTGACCATCTGTAGGG + Intronic
964429840 3:156593940-156593962 GGGCCCTGGAAGCCTCTGAAAGG - Intergenic
965305276 3:167056949-167056971 GGCCTCCACCACCATCTGAAAGG + Intergenic
966216721 3:177511034-177511056 GGCATCTGGAACCATCTGGAGGG + Intergenic
967275469 3:187769918-187769940 AGCCCCTGGAACTTTCTGAAAGG - Intergenic
968867520 4:3223211-3223233 GGGCCCTGAAACAATCTGATGGG - Intronic
968923872 4:3536813-3536835 GGGCCCCCCAGCCATCTGAATGG + Intergenic
969198950 4:5586407-5586429 CCCCCCCTCAACCATCTGAATGG + Intronic
970161783 4:13196754-13196776 GGCCCCTGGAACCATGTCATGGG - Intergenic
970205662 4:13653453-13653475 AGCCCCTCCAAGCATCTGAATGG + Intergenic
973824740 4:54693682-54693704 GTCCCCTGCCACCATATGCAAGG - Intronic
975615009 4:76237324-76237346 AGGCCCCTCAACCATCTGAATGG - Intronic
976112094 4:81686382-81686404 GGCCCCTCCAACCATTTGAATGG - Intronic
977352095 4:95901351-95901373 AGGCCCTCCAATCATCTGAATGG - Intergenic
977468240 4:97408809-97408831 GGATCCCCCAACCATCTGAATGG - Intronic
977610546 4:99025639-99025661 GCCCCCAGCAACCATCTGAATGG + Intronic
978423019 4:108554138-108554160 GACCCCCGCAACCATTTGAATGG + Intergenic
979059587 4:116041027-116041049 GGCCCCTGCCATCCTCTGTATGG - Intergenic
979183737 4:117760649-117760671 GACCTCTGCAACCATCTGAATGG - Intergenic
980985017 4:139686499-139686521 AGGCCCCCCAACCATCTGAATGG - Intronic
981069054 4:140515865-140515887 AGCACCTGCAACCAACTGAATGG + Intergenic
981805627 4:148711833-148711855 GTCCCCCACAACCAACTGAATGG - Intergenic
983781733 4:171677067-171677089 GGCACCCACAGCCATCTGAATGG - Intergenic
983863810 4:172739156-172739178 AGGCCCTCCAACCATCTAAATGG - Intronic
984096685 4:175443698-175443720 GGTCCCTGCAACCATCTGAATGG - Intergenic
986922962 5:12709768-12709790 GCCCCCTGCAGCCATCTGAATGG - Intergenic
988768868 5:34410907-34410929 GGCTCCCGCAATCATCTGAATGG - Intergenic
989282202 5:39657492-39657514 GCCCCCTGCAACTATCTCAATGG + Intergenic
989445981 5:41529029-41529051 GCCCCCTGCAACCATCTGAATGG + Intergenic
990614227 5:57490613-57490635 AGACCCCCCAACCATCTGAAAGG - Intergenic
992540516 5:77759505-77759527 GCCCCCCATAACCATCTGAATGG - Intronic
995740798 5:115354094-115354116 TTCACCTCCAACCATCTGAATGG - Intergenic
995849799 5:116533194-116533216 GTGCCCTGGAACCCTCTGAATGG + Intronic
996688740 5:126314055-126314077 AGGCCCTCCAACCATCTGAATGG - Intergenic
996708051 5:126517305-126517327 GACCCCCCCAACCAACTGAATGG + Intergenic
997756798 5:136407113-136407135 TGTCCCTACAACCATCTGAATGG - Intergenic
998178190 5:139914911-139914933 GGCCCCTGTAACCAGCTGGGGGG - Intronic
998261804 5:140637506-140637528 GCCCCCCACAACCATCTGAATGG + Intergenic
999111960 5:149129223-149129245 GGCACCTGAAACCAGCAGAATGG - Intergenic
999668793 5:153940241-153940263 AGGCCCCACAACCATCTGAATGG + Intergenic
1000231123 5:159316327-159316349 GGGCCCTGAAACCCACTGAAGGG - Intronic
1001282650 5:170398229-170398251 GGTCCTCCCAACCATCTGAATGG - Intronic
1001556446 5:172640831-172640853 GGCCCCTGGGACCATGTAAAGGG - Intergenic
1002410247 5:179069098-179069120 GCCCCCTGCAGCTGTCTGAATGG + Intronic
1003100867 6:3175617-3175639 GGCCCCCCCAACCATCTGAATGG - Intergenic
1004085760 6:12447465-12447487 GGCCCCAGCAAGAATTTGAAAGG - Intergenic
1005331861 6:24758374-24758396 AGGCCCCCCAACCATCTGAATGG - Intergenic
1006254479 6:32819376-32819398 CTCCCTTGCAACCATCTAAATGG - Intronic
1007039889 6:38711961-38711983 TGCCGCCCCAACCATCTGAATGG + Intergenic
1007861583 6:44915453-44915475 AGGCCCCCCAACCATCTGAATGG + Intronic
1011510792 6:88098723-88098745 GCACCCCTCAACCATCTGAATGG + Intergenic
1014171991 6:118288785-118288807 GGCCCCCCCAACCATCTGAATGG - Intronic
1014550781 6:122787681-122787703 GCCCCCCACAACCATCTGAATGG - Intergenic
1014665744 6:124234985-124235007 GCCACCTGTCACCATCTGAATGG - Intronic
1015070333 6:129086274-129086296 GGTACCTGAAACCATCTGAGAGG + Intronic
1015473897 6:133637580-133637602 GGTCTCTGCAGCCAACTGAATGG - Intergenic
1016278258 6:142380345-142380367 GCCCCCCACAACCATCTGAATGG - Intronic
1016494235 6:144641591-144641613 TGCCCCCCTAACCATCTGAATGG - Intronic
1018155561 6:160982408-160982430 GTCCCCCCCAACCATCTGATTGG + Intergenic
1018176165 6:161181185-161181207 GGCCCCAGCAACGCTGTGAAGGG + Intronic
1018561365 6:165103753-165103775 GGCCCACACAACCATCTGAATGG - Intergenic
1019030143 6:169003271-169003293 GGCCCCACCAACGATCTGAATGG + Intergenic
1020363166 7:7351823-7351845 GCCCCCCTCTACCATCTGAATGG + Intergenic
1020808413 7:12820791-12820813 CCCCCCTGCAATTATCTGAATGG + Intergenic
1022677453 7:32513222-32513244 CACCCCTGCAACCATCCCAATGG + Intronic
1023125628 7:36951513-36951535 GGCCACTGGAACCACCTGGAGGG + Intronic
1023293750 7:38693165-38693187 GGGCCCCCCAACCATTTGAATGG - Intergenic
1028456599 7:91044637-91044659 AAGCCCTTCAACCATCTGAACGG - Intronic
1028847449 7:95497834-95497856 GGTCCATGCAACCATATGGATGG - Intronic
1029291345 7:99504547-99504569 GGGCCCTGCCACCTTCTGATAGG + Intergenic
1030190869 7:106808909-106808931 GCCTCCTGCAACCATCTGAATGG - Intergenic
1030877448 7:114832500-114832522 CTCTCCTTCAACCATCTGAATGG - Intergenic
1030994476 7:116341744-116341766 GGCCCCTGCATTAATCTGTAGGG - Intronic
1031227160 7:119054047-119054069 GGAACCCCCAACCATCTGAATGG - Intergenic
1032283268 7:130523284-130523306 GGCCTATCCAATCATCTGAAGGG + Intronic
1032284012 7:130527510-130527532 GGCCTATCCAATCATCTGAAGGG + Intronic
1034245734 7:149643099-149643121 TGCCCCTGCCACCAGCTGGAGGG + Intergenic
1034735959 7:153429854-153429876 GGGGCCCCCAACCATCTGAATGG + Intergenic
1036583884 8:10104835-10104857 GCCCCTCTCAACCATCTGAATGG - Intronic
1036689024 8:10929727-10929749 GGCCCCTGTGACCCTCTGAGGGG - Intronic
1037994959 8:23345359-23345381 GTCCCCTTCAACCAGCTGAAGGG + Intronic
1039264222 8:35807385-35807407 AAGCCCTTCAACCATCTGAATGG - Intergenic
1039501913 8:38024668-38024690 TCCCCCCACAACCATCTGAATGG + Intergenic
1040621007 8:49092823-49092845 GTGCCCCACAACCATCTGAATGG + Intergenic
1041406161 8:57501615-57501637 AGCCCCCTCAACCAACTGAACGG - Intergenic
1043413127 8:80020406-80020428 AGCCCCCTCAACCATCTGAATGG - Intronic
1043947935 8:86275298-86275320 GGCCCCTCTAGCCAACTGAAAGG - Intronic
1043948670 8:86282998-86283020 GCCCCCACCAACCATCTGAACGG - Intronic
1044593859 8:93940042-93940064 GCCCCCCCCAACCATCTAAATGG - Intergenic
1044607407 8:94059242-94059264 AGCCCCTGCAACTGACTGAACGG + Intergenic
1044931999 8:97260060-97260082 AGCCCCCTCAACCAGCTGAAGGG + Intergenic
1045253098 8:100497536-100497558 CCCCCCGCCAACCATCTGAATGG - Intergenic
1045332038 8:101163486-101163508 AGGCCCCTCAACCATCTGAATGG - Intergenic
1047113952 8:121819595-121819617 GGCCCCCTCAACCATCTGAATGG - Intergenic
1048671795 8:136730710-136730732 AGGCCCCCCAACCATCTGAATGG + Intergenic
1049467567 8:142759013-142759035 GCCCTCCACAACCATCTGAATGG + Intergenic
1049890613 9:66826-66848 AGGCCCCTCAACCATCTGAATGG + Intergenic
1051050503 9:12927111-12927133 GCCCCCACCAACCATCTGAGTGG + Intergenic
1051065640 9:13099227-13099249 AGGCCCCCCAACCATCTGAATGG + Intergenic
1051272767 9:15371498-15371520 GCCCCCCAAAACCATCTGAATGG + Intergenic
1053732082 9:41068009-41068031 AGGCCCCTCAACCATCTGAATGG + Intergenic
1053799586 9:41755838-41755860 GGGCCCCCCAGCCATCTGAATGG + Intergenic
1054145633 9:61559160-61559182 GGGCCCCCCAGCCATCTGAATGG - Intergenic
1054187995 9:61967898-61967920 GGGCCCCCCAGCCATCTGAATGG + Intergenic
1054650520 9:67620683-67620705 GGGCCCCCCAGCCATCTGAATGG - Intergenic
1054696375 9:68363708-68363730 AGGCCCCTCAACCATCTGAATGG - Intronic
1054779991 9:69157134-69157156 GGCCCCTGCAACCATCTGAATGG - Intronic
1054911397 9:70458409-70458431 GGCCCCCCCAACCATCCAAATGG - Intergenic
1056453308 9:86737486-86737508 GTGCCCTGCAAGCTTCTGAAAGG + Intergenic
1056521564 9:87406845-87406867 GAGCCCTGTAACCGTCTGAATGG + Intergenic
1056921288 9:90791428-90791450 CCCTCCTCCAACCATCTGAATGG - Intergenic
1058449681 9:105084400-105084422 ACCCTCTGCAACCATCTGAGTGG + Intergenic
1059389993 9:113993089-113993111 GACGCCTGCACCCATCTGACAGG + Intronic
1059752300 9:117259320-117259342 GCCCCCCTCAACCATCTGAATGG + Intronic
1061031149 9:128084102-128084124 AGCCCCACCAACCAACTGAATGG + Intronic
1062166101 9:135108056-135108078 GGCCCCCGCCCCCATCTGGAAGG + Intronic
1062215606 9:135388023-135388045 AGGCCCCCCAACCATCTGAATGG + Intergenic
1062434588 9:136541282-136541304 GGGCCCTGCAACCACCTGATTGG + Intronic
1062611075 9:137373694-137373716 GGCCACAGCTACCTTCTGAATGG - Intronic
1185788884 X:2913457-2913479 GCCCCCCACAACCATCTGAATGG - Intronic
1185910601 X:3977172-3977194 GGCCCCCCCACCCATCTGAATGG - Intergenic
1186007497 X:5089554-5089576 GACCCCTCTAACCATCTGAATGG + Intergenic
1186176377 X:6929715-6929737 AGCCCCCTCAGCCATCTGAATGG - Intergenic
1186691290 X:11978372-11978394 AGGCCCCCCAACCATCTGAATGG - Intergenic
1188904159 X:35772389-35772411 TCCCCCCTCAACCATCTGAATGG - Intergenic
1188908977 X:35822539-35822561 GCCCCCTGGATCCATCTGAATGG + Intergenic
1189748280 X:44192897-44192919 AGGCCCCCCAACCATCTGAATGG + Intronic
1190179517 X:48180101-48180123 CCACCCCGCAACCATCTGAATGG - Intergenic
1190498312 X:51049221-51049243 AGCCCCCCCAACCATCTGATTGG - Intergenic
1190604701 X:52128640-52128662 GCCTCCTGCAACCATCTGAATGG + Intergenic
1191069504 X:56384753-56384775 GCCCTCTGCAACCATCTGAATGG - Intergenic
1191127764 X:56975623-56975645 GGCCCCCCCAACCATCTGAATGG - Intergenic
1191778528 X:64843977-64843999 AGCCCCTGCAACCTCCTGGAGGG - Intergenic
1193283937 X:79689334-79689356 ACCCCCTGCAACCATCTGAATGG - Intergenic
1194141286 X:90213620-90213642 GGTCCCTGCAGCCTTCTGCAGGG - Intergenic
1194279835 X:91936127-91936149 GCCCCCTGCAACCATCTGAATGG - Intronic
1194802946 X:98294038-98294060 GCCACCTGCAACCATCTGAATGG - Intergenic
1195256453 X:103095707-103095729 AGTCCCCTCAACCATCTGAATGG + Intergenic
1195546442 X:106117282-106117304 TTCCCCCCCAACCATCTGAATGG - Intergenic
1195759227 X:108227882-108227904 GGTCCCCCCAACCATCTGAATGG - Intronic
1198123609 X:133620519-133620541 AGGCCCCTCAACCATCTGAATGG + Intronic
1199336743 X:146627573-146627595 AGGCCCACCAACCATCTGAATGG + Intergenic
1199909796 X:152272859-152272881 TGTCCCTGCAACCATGTGAAGGG + Intronic
1200210602 X:154345226-154345248 GGCCCATGCACCCACCTGGACGG + Intergenic
1200220250 X:154386866-154386888 GGCCCATGCACCCACCTGGACGG - Intergenic
1200384017 X:155870447-155870469 GGCCCCCTCAACCATCTAAATGG - Intergenic
1200487040 Y:3782722-3782744 GGTCCCTGCAGCCTTCTGCAGGG - Intergenic
1200597312 Y:5159607-5159629 GCCCCCTGCAACCATCTGAATGG - Intronic
1200880956 Y:8210824-8210846 GGCCCCTGCACCCTGCTGATAGG + Intergenic
1201286087 Y:12379908-12379930 GCCCCCCACAACCATCTGAATGG + Intergenic
1201318176 Y:12668651-12668673 AAGCCCTCCAACCATCTGAATGG - Intergenic
1201319216 Y:12678601-12678623 AAGCCCTTCAACCATCTGAATGG - Intergenic
1201433767 Y:13933651-13933673 AAGCCCTCCAACCATCTGAAGGG + Intergenic
1201673129 Y:16547689-16547711 GGCCTCTTCAACCATCTGAATGG - Intergenic