ID: 1054782558

View in Genome Browser
Species Human (GRCh38)
Location 9:69178571-69178593
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054782554_1054782558 7 Left 1054782554 9:69178541-69178563 CCTTGACCACGCCTTCAAGAAAG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1054782558 9:69178571-69178593 CAGAATGGCCCAGAATAGCCAGG No data
1054782556_1054782558 -4 Left 1054782556 9:69178552-69178574 CCTTCAAGAAAGTCAAACACAGA 0: 1
1: 0
2: 4
3: 34
4: 392
Right 1054782558 9:69178571-69178593 CAGAATGGCCCAGAATAGCCAGG No data
1054782553_1054782558 16 Left 1054782553 9:69178532-69178554 CCTGGTATACCTTGACCACGCCT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1054782558 9:69178571-69178593 CAGAATGGCCCAGAATAGCCAGG No data
1054782555_1054782558 1 Left 1054782555 9:69178547-69178569 CCACGCCTTCAAGAAAGTCAAAC 0: 1
1: 0
2: 0
3: 2
4: 85
Right 1054782558 9:69178571-69178593 CAGAATGGCCCAGAATAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr