ID: 1054783965

View in Genome Browser
Species Human (GRCh38)
Location 9:69192717-69192739
Sequence GCAGCACGCTACTGAGGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054783965_1054783969 -8 Left 1054783965 9:69192717-69192739 CCTACTCCTCAGTAGCGTGCTGC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1054783969 9:69192732-69192754 CGTGCTGCAGCAGTGGCTTTGGG No data
1054783965_1054783970 -2 Left 1054783965 9:69192717-69192739 CCTACTCCTCAGTAGCGTGCTGC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1054783970 9:69192738-69192760 GCAGCAGTGGCTTTGGGACCTGG No data
1054783965_1054783968 -9 Left 1054783965 9:69192717-69192739 CCTACTCCTCAGTAGCGTGCTGC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1054783968 9:69192731-69192753 GCGTGCTGCAGCAGTGGCTTTGG No data
1054783965_1054783972 13 Left 1054783965 9:69192717-69192739 CCTACTCCTCAGTAGCGTGCTGC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1054783972 9:69192753-69192775 GGACCTGGTGTAGACATTATGGG No data
1054783965_1054783971 12 Left 1054783965 9:69192717-69192739 CCTACTCCTCAGTAGCGTGCTGC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1054783971 9:69192752-69192774 GGGACCTGGTGTAGACATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054783965 Original CRISPR GCAGCACGCTACTGAGGAGT AGG (reversed) Intronic
900433589 1:2615163-2615185 GCAGCTCACACCTGAGGAGTGGG - Intronic
904389076 1:30168940-30168962 TCAGCAAACTACTGAGAAGTGGG + Intergenic
907894400 1:58671937-58671959 GCATCTCTCTGCTGAGGAGTTGG - Exonic
912959049 1:114179151-114179173 TCAGCACACTACTGATGAGGTGG - Intergenic
914745847 1:150500476-150500498 GCCTCAGGCTACTGAGTAGTTGG - Intronic
923051217 1:230392681-230392703 GCAGGCCGCTGCTGAGGAGCGGG - Intronic
1064128070 10:12681548-12681570 GCAGAATGCTGCTGAGGAATGGG - Intronic
1072012749 10:91317998-91318020 GCAGCACAATGCTAAGGAGTGGG + Intergenic
1076178595 10:128387791-128387813 GCAGCTTCCTCCTGAGGAGTTGG + Intergenic
1078530854 11:12135840-12135862 GCTGCATGCTGCTGAGGGGTCGG + Intronic
1080518315 11:33043479-33043501 GAAACATGCTACTTAGGAGTAGG + Intronic
1083757146 11:64797654-64797676 GCAGCAGGCTCCTGGGCAGTGGG + Exonic
1096158061 12:49352759-49352781 GGAACAAGCTACTGTGGAGTGGG + Exonic
1102909950 12:116705687-116705709 GTTGCACGCCACTGCGGAGTTGG - Intergenic
1113066011 13:106374948-106374970 GCAACAAGCTAAGGAGGAGTCGG + Intergenic
1121441101 14:93949909-93949931 TCAGCACGCGCCTGAGCAGTGGG - Intronic
1122898500 14:104772244-104772266 GCAGCAGGCTCCTGAGGTGAGGG + Intronic
1127256948 15:57300622-57300644 GCTGCACGTGACAGAGGAGTTGG + Intergenic
1129030122 15:72611824-72611846 GCAGCATAGGACTGAGGAGTTGG + Intergenic
1129747992 15:78038318-78038340 GAAGCACGGCAGTGAGGAGTGGG + Intronic
1138356236 16:56383281-56383303 GCAGCACAGCACAGAGGAGTTGG - Intronic
1143853733 17:9832893-9832915 TCATCAAGCTACTGAGGAGTTGG - Intronic
1150484217 17:65532830-65532852 ACAGCACACAGCTGAGGAGTTGG + Intronic
1165072799 19:33265319-33265341 GCAGGACGCTGCTGAGGAAAAGG - Intergenic
1165083902 19:33329320-33329342 GCAGCACGCTGCTGAGGACCAGG - Intergenic
930750205 2:54927196-54927218 TCAGTACTCTGCTGAGGAGTGGG + Intronic
937240721 2:120460748-120460770 GCAGGAGGGGACTGAGGAGTGGG - Intergenic
938792507 2:134689537-134689559 GCAGCAGGCCTCTCAGGAGTGGG - Intronic
942921429 2:181378356-181378378 GCAGAACTCTCCTGAGGAATAGG - Intergenic
1170121863 20:12920990-12921012 GGAGCACTCTACTGAGAAGTTGG - Intergenic
1172755567 20:37281496-37281518 GAAGCAAGGTACTGAGCAGTGGG - Intergenic
1174427479 20:50442634-50442656 GCAGAACGCCTCTGAGAAGTTGG - Intergenic
952203930 3:31160137-31160159 TCAGCATCCTACTGAGTAGTGGG - Intergenic
953881768 3:46694552-46694574 TCAGCCCCCTACTGAGGAGGTGG + Intergenic
954751853 3:52818311-52818333 GCAGCCCCTTCCTGAGGAGTGGG + Exonic
955029174 3:55199868-55199890 GCAGGAAGCTATTGAGGAGGAGG + Intergenic
962743143 3:138377783-138377805 GCAGCACGATGATGAGGAGAAGG + Intronic
967683012 3:192387196-192387218 GGAACACCCTACTGAGGAGCTGG + Intronic
970620083 4:17809611-17809633 GCAGTAGGTTACTGAGGTGTAGG + Intronic
978881786 4:113713118-113713140 GCATTACCCTACTGAGGAGATGG + Intronic
985596823 5:796025-796047 GGAGCACAGTACTGAGAAGTGGG - Exonic
1011580900 6:88863238-88863260 GCAGCATGCCACTGAAGATTTGG + Intronic
1014569843 6:122996042-122996064 TCAGCAGCCTGCTGAGGAGTGGG + Exonic
1020286322 7:6684053-6684075 GCCTCACGCTCCTGAGTAGTGGG + Intergenic
1022112606 7:27240576-27240598 GCAGCAGGCTACTCACGAGAAGG + Intergenic
1028290370 7:89057710-89057732 GAAGCAGGCCACTGTGGAGTGGG + Intronic
1030303134 7:107993872-107993894 ACAGCAGGCTGCTGGGGAGTGGG + Intronic
1032336505 7:131029702-131029724 GCAGCACTCTCCTGAGGACCTGG + Intergenic
1034273552 7:149814564-149814586 GCACCACCGTGCTGAGGAGTGGG - Intergenic
1037108197 8:15136174-15136196 GCAGGACTCTACTCAGGAGGTGG - Intronic
1037198733 8:16223976-16223998 GCAGAACTCTACTCAGGAGATGG + Intronic
1041775032 8:61514246-61514268 GCATCAGGCTACTGAAGACTAGG + Intronic
1047934298 8:129761738-129761760 GCAGCTCTCTAATGAGGAGAAGG - Intronic
1047939958 8:129820020-129820042 GCAGCTCTCTAATGAGGAGTCGG + Intergenic
1054783965 9:69192717-69192739 GCAGCACGCTACTGAGGAGTAGG - Intronic
1057294925 9:93829381-93829403 GCAGCACAGTGCTGAGGAGAGGG + Intergenic
1061625006 9:131836428-131836450 GCACCACGCTACCGAGGACGAGG - Intergenic
1187877487 X:23816302-23816324 GCATTACGATCCTGAGGAGTTGG - Intergenic
1190008032 X:46758843-46758865 GGAGCTCGCTACTGAGAAGGAGG - Exonic