ID: 1054784802

View in Genome Browser
Species Human (GRCh38)
Location 9:69200422-69200444
Sequence GTATTGCCAAGGCTGGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054784799_1054784802 5 Left 1054784799 9:69200394-69200416 CCTTTTTTTCTAGACACAGGATC 0: 1
1: 0
2: 9
3: 112
4: 600
Right 1054784802 9:69200422-69200444 GTATTGCCAAGGCTGGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054784802 Original CRISPR GTATTGCCAAGGCTGGAGTG TGG Intronic
No off target data available for this crispr