ID: 1054785611

View in Genome Browser
Species Human (GRCh38)
Location 9:69207318-69207340
Sequence GAGCAAAAAAACACCCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054785611_1054785613 12 Left 1054785611 9:69207318-69207340 CCTTCTGGGGTGTTTTTTTGCTC No data
Right 1054785613 9:69207353-69207375 GAGATGCATCCCTTTTGTGGTGG No data
1054785611_1054785616 25 Left 1054785611 9:69207318-69207340 CCTTCTGGGGTGTTTTTTTGCTC No data
Right 1054785616 9:69207366-69207388 TTTGTGGTGGTCTATGTGACTGG No data
1054785611_1054785612 9 Left 1054785611 9:69207318-69207340 CCTTCTGGGGTGTTTTTTTGCTC No data
Right 1054785612 9:69207350-69207372 TTTGAGATGCATCCCTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054785611 Original CRISPR GAGCAAAAAAACACCCCAGA AGG (reversed) Intronic