ID: 1054785613

View in Genome Browser
Species Human (GRCh38)
Location 9:69207353-69207375
Sequence GAGATGCATCCCTTTTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054785611_1054785613 12 Left 1054785611 9:69207318-69207340 CCTTCTGGGGTGTTTTTTTGCTC No data
Right 1054785613 9:69207353-69207375 GAGATGCATCCCTTTTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054785613 Original CRISPR GAGATGCATCCCTTTTGTGG TGG Intronic