ID: 1054787655

View in Genome Browser
Species Human (GRCh38)
Location 9:69224223-69224245
Sequence GAATTCAGTGGGTGAAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 398}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054787655 Original CRISPR GAATTCAGTGGGTGAAGAAA AGG (reversed) Intronic
900708579 1:4096073-4096095 GAATCCCCTGGGAGAAGAAAGGG + Intergenic
901124955 1:6922718-6922740 GTATTCAGTGGGAGGAGAATTGG + Intronic
902695634 1:18139021-18139043 GAATTCAGTGGGTAAGGATGTGG - Intronic
902964751 1:19991798-19991820 GAGTTCAATAGGTGCAGAAAAGG - Intergenic
908412953 1:63885065-63885087 GAGTTCAGTGGGTTAATACATGG + Intronic
908557102 1:65266661-65266683 GTTTTCAGTGGTTGGAGAAAGGG + Intronic
908590846 1:65631356-65631378 GGAGACAGTGCGTGAAGAAATGG - Intronic
910395393 1:86788592-86788614 GGATTCAGTGAGTTAATAAAGGG + Intergenic
910800178 1:91137561-91137583 GTATTCAGTGGGTAGAGTAAGGG + Intergenic
910867458 1:91801413-91801435 GAATCCACTGGGTGAGGAGAGGG + Intronic
910867655 1:91802877-91802899 GAATCCATTGGGTGAGGAGAGGG - Intronic
911555071 1:99333645-99333667 GAATTCAGTGGGTGAAATTGAGG - Intergenic
912155507 1:106914063-106914085 GAAATAAGTGGGTGAAGAGGAGG + Intergenic
913083255 1:115409632-115409654 GCATTCACTGGGTGAGGAGATGG - Intergenic
913682121 1:121196014-121196036 GATTTCAATAGGTGAAGATACGG - Intronic
913981852 1:143527139-143527161 GAAATCATTGAGGGAAGAAAAGG + Intergenic
914033957 1:143983634-143983656 GATTTCAATAGGTGAAGATACGG - Intergenic
914155490 1:145084338-145084360 GATTTCAATAGGTGAAGATACGG + Intronic
914424186 1:147559785-147559807 GAAGTCAGTGGGGAAAGTAAGGG - Intronic
915028991 1:152859949-152859971 GAATGCAGTGTGTGTATAAAAGG + Intergenic
915676616 1:157538056-157538078 GCATTTAGTAGGTGAAGAAGTGG + Intronic
919266468 1:195273660-195273682 GATTTCAGTGTATGAGGAAAAGG + Intergenic
919639756 1:200036439-200036461 GAGTTCTGAGGGAGAAGAAAGGG + Intronic
919790754 1:201289292-201289314 GATTTCAGAGGGTGAAGTAAAGG + Intronic
919972031 1:202587227-202587249 GAATGCAGAGGGAGATGAAAGGG - Exonic
920469434 1:206214523-206214545 GATTTCAATAGGTGAAGATACGG - Intronic
920723846 1:208415313-208415335 GAATTCAATAGGGGAAGAAAGGG - Intergenic
920837494 1:209525247-209525269 GAATTTGCTGGGTGAAGAAAAGG + Intergenic
921176597 1:212600448-212600470 GCATTCAGTGGATGAAAATACGG - Intronic
921320015 1:213929710-213929732 GAATTCAGTGAGAGAGGAAAGGG + Intergenic
921629442 1:217416115-217416137 GAGTTAAGTGGAAGAAGAAAAGG + Intergenic
921721201 1:218473560-218473582 GAAGTCAGGGGGAGATGAAAGGG + Intergenic
923450217 1:234110109-234110131 GAATTGAGAAGGTGGAGAAAAGG + Intronic
923459348 1:234195174-234195196 GAAAGCAGTGGGCAAAGAAATGG - Intronic
923694527 1:236234378-236234400 GTATTAAGTGGCTGTAGAAAAGG + Intronic
923702717 1:236315416-236315438 GAAGTTAGTGTGTGAAGAAATGG - Intergenic
1064233190 10:13548178-13548200 GAATTCAGTGGAAGAAGAAGAGG + Intergenic
1064465928 10:15581893-15581915 TAATTCAGTGGGGGGAAAAATGG + Intronic
1064755953 10:18572044-18572066 GAATTCAGTGGGAAATGGAATGG - Intronic
1064894268 10:20216155-20216177 GAAATGAGTGGTTGAAGTAATGG + Intronic
1065102266 10:22341888-22341910 TAATTCAGAGGATGAAGAGATGG - Intergenic
1065153845 10:22849779-22849801 CAAATCAGTGAGTGAAAAAAAGG + Intergenic
1065869185 10:29941431-29941453 GAAGTCAGAGGGTGAAAAGAAGG + Intergenic
1066376631 10:34863126-34863148 GAAAACAGTGGGAAAAGAAAAGG - Intergenic
1066580346 10:36873816-36873838 GAATTCAGTGTGAAAAGAAAAGG + Intergenic
1068280588 10:54863682-54863704 AAATACTGTGGGAGAAGAAAAGG + Intronic
1069335061 10:67338891-67338913 GTATTCATTGGTTGAAGAATAGG - Intronic
1071333444 10:84583368-84583390 GAATTCAGGGGGCCAAGAACAGG - Intergenic
1071817802 10:89251035-89251057 CAGTTCAGTGGCAGAAGAAAAGG + Intronic
1072615397 10:97046270-97046292 TGATTCAGTGGGTGTAGATAGGG - Intronic
1072904618 10:99441277-99441299 GATTTCAATCCGTGAAGAAAGGG - Intergenic
1072941003 10:99763777-99763799 CAATTCAGTGGGGGAAAGAATGG + Intergenic
1073839895 10:107486287-107486309 TAATTCAAAGGGTGAACAAAAGG + Intergenic
1075609135 10:123837110-123837132 GAATTCTGATGGTGAAGGAAAGG - Intronic
1076089095 10:127664084-127664106 GAAAACAGTGAGTGAAGGAATGG - Intergenic
1078464312 11:11539078-11539100 TAATTCAGTCGCTGAACAAATGG + Intronic
1078473474 11:11610489-11610511 GAATTCATCTGGAGAAGAAATGG - Intronic
1078979087 11:16511601-16511623 GAATTCAGTGGGTGGATGCAAGG - Intronic
1079433208 11:20417150-20417172 TAATTCAGTGAGAGAAAAAAGGG - Intronic
1081054092 11:38386508-38386530 AAATTCAGTGGTTGAAACAATGG + Intergenic
1081154987 11:39679615-39679637 GAAATCAGTAGGTGAATGAATGG - Intergenic
1081848897 11:46261090-46261112 GAAGGCAGTGGGTGGAGACAAGG - Intergenic
1082299717 11:50491334-50491356 GAATTCCATGGGGAAAGAAAAGG + Intergenic
1083904309 11:65660179-65660201 GAATCCAGTGTGTGAAGAAGCGG - Exonic
1083922777 11:65789433-65789455 GAATCCTGTGGGTCAAGTAAAGG + Intronic
1085602430 11:77867293-77867315 GAATGCAGTGGTTGTAGAAGGGG - Intronic
1086028339 11:82322425-82322447 GAATTCAATGGGTTATGAAAAGG + Intergenic
1086110785 11:83195679-83195701 GGATACAGTGGGTGAAACAAGGG - Intronic
1086238793 11:84663869-84663891 GAATTGAGTAGGGGAAGAGAGGG - Intronic
1086254942 11:84864539-84864561 GAATACAGTGGGTGCAAATATGG - Intronic
1086490267 11:87352427-87352449 GATTTCAGTAGGTGACAAAAGGG - Intergenic
1087057805 11:93950743-93950765 GAATTCAGTAGGTACAGATATGG - Intergenic
1090274560 11:125410358-125410380 GAATTCCCTGGGAGGAGAAAGGG + Intronic
1090535273 11:127634305-127634327 AAAATGAGTGGGTGAAGGAAGGG + Intergenic
1090633015 11:128666904-128666926 GCATCCAGTGGGTGAAGACCAGG - Intergenic
1090732904 11:129587148-129587170 GAATTTGGAGGGTGAAGAAGAGG - Intergenic
1090897760 11:130993874-130993896 AAATTCAGTTGGTAAAGAAGAGG + Intergenic
1091167971 11:133497254-133497276 AAATTCAGAGCTTGAAGAAAAGG - Intronic
1091674455 12:2478774-2478796 GAGTGCAGTGGTTGAAGAAGAGG - Intronic
1094290653 12:28845059-28845081 CAATTCAATGGATGAAGAAAGGG - Intergenic
1094433131 12:30392388-30392410 GAATTGAGTAGGAGAAAAAATGG + Intergenic
1094554951 12:31489872-31489894 GAATTCACTAGGTGAAGGAGAGG + Intronic
1096786331 12:54019078-54019100 GAATTTAGCGGGGGCAGAAAAGG - Intronic
1097071021 12:56354945-56354967 GAATTTTGTGGAGGAAGAAAGGG + Intronic
1097969577 12:65618477-65618499 AAATTCATTGGGTGAATGAAAGG + Intergenic
1098147458 12:67511986-67512008 AAATTGAGTGGGAGAGGAAATGG - Intergenic
1098855658 12:75650468-75650490 AAATTGAGTGGGAGAAGAATAGG - Intergenic
1098979624 12:76941766-76941788 TAATTCTCTGGGTGAAAAAAAGG - Intergenic
1100063967 12:90617326-90617348 GAGTTCAGTGGATGAAAAAAGGG + Intergenic
1100769638 12:97907662-97907684 CACTTCAGTGGATGAAAAAAAGG + Intergenic
1100817598 12:98401005-98401027 GAATTCAGAAGGGGAAGACAGGG - Intergenic
1100829401 12:98503976-98503998 GAAATCATTTGGTAAAGAAAAGG + Intergenic
1102924154 12:116814193-116814215 TGGTTCAGTGGATGAAGAAATGG - Intronic
1103020927 12:117533720-117533742 GGATTCAGTGTCTGCAGAAAAGG + Intronic
1103221814 12:119252661-119252683 GACTTCACTGGTTGAAGACATGG + Intergenic
1103227610 12:119301678-119301700 GAATTTTATGGATGAAGAAATGG - Intergenic
1106123849 13:26883893-26883915 GAATCATGTGGGTGAAGAACAGG - Intergenic
1106564120 13:30870700-30870722 GCATTCTGTGGGTGGAGACAGGG + Intergenic
1108118280 13:47154443-47154465 CAATTCAGTGCTGGAAGAAAAGG - Intergenic
1108916906 13:55625028-55625050 GACTTCAGTGGATGAAGTAATGG + Intergenic
1109258513 13:60113901-60113923 GCATTCAGTTGGTGAAGACTAGG - Intronic
1109436012 13:62303706-62303728 TATTTCAGTAGATGAAGAAAAGG - Intergenic
1110178967 13:72592523-72592545 GAATTGAGGGAGAGAAGAAAAGG + Intergenic
1110210438 13:72966129-72966151 GAATTAAGTGGGAATAGAAATGG + Intronic
1111102186 13:83602758-83602780 GAATTCCATAGGTGAAAAAAAGG - Intergenic
1111325283 13:86686340-86686362 GACTTCAGTGATTGAAGAAGAGG + Intergenic
1111961101 13:94811455-94811477 GAGTTGAGAGGGAGAAGAAAAGG - Intergenic
1112742792 13:102494269-102494291 GAAATCATAGAGTGAAGAAAAGG - Intergenic
1113511411 13:110857647-110857669 GAGATCAGATGGTGAAGAAATGG + Intergenic
1113762437 13:112859016-112859038 CAATTCTGTGGGGGGAGAAAAGG - Intronic
1114367118 14:22041029-22041051 GTATTCAGCTGGGGAAGAAAAGG + Intergenic
1114457596 14:22866661-22866683 GAGTTATGGGGGTGAAGAAAGGG - Intergenic
1115707213 14:36011588-36011610 GAACTCAGTTGGTGTGGAAAGGG - Intergenic
1116360342 14:43987725-43987747 GAAATAAGTGAGTGATGAAAAGG - Intergenic
1117150432 14:52881849-52881871 GAATTCAGAAGGTAAAGGAAAGG + Intronic
1117424181 14:55578947-55578969 AAATTCTGTTGGTGTAGAAACGG + Intronic
1118605022 14:67496527-67496549 GAAATTAGTTTGTGAAGAAAAGG + Intronic
1118960254 14:70523503-70523525 GAATCTAGTGGTTGAAGAAGGGG - Exonic
1120077412 14:80174578-80174600 TAATGCAGTGGGGGAATAAATGG - Intergenic
1120143780 14:80957179-80957201 GCATTAGCTGGGTGAAGAAATGG - Intronic
1120158670 14:81121976-81121998 GAATTCATTGTGTGAAAAACTGG + Intronic
1120295796 14:82638540-82638562 GAATGCAGTTGCTGAATAAATGG - Intergenic
1121682423 14:95804732-95804754 AACTTTAGTGGGTGAAGACATGG + Intergenic
1122084570 14:99290664-99290686 GAACTCAGTGGGTGCAGGAATGG + Intergenic
1122776679 14:104119943-104119965 GAATTCCATGGCTGAAGGAATGG - Intergenic
1122907219 14:104807380-104807402 GAATGCTGAGGCTGAAGAAAGGG - Intergenic
1123484253 15:20672381-20672403 GACTTCAGTCAGTGAAGAATAGG - Intergenic
1123765350 15:23472383-23472405 GCATTCAGTGGGGAAAGAGAAGG + Intergenic
1125401035 15:39303481-39303503 GATTTCAGTGGATGAACTAACGG - Intergenic
1127047900 15:55046707-55046729 GAATTAACTGGATGAAGAATGGG - Intergenic
1127356132 15:58201877-58201899 CAATTCAGTGGGGGAAAGAATGG + Intronic
1128871681 15:71162729-71162751 GACTTCAGAAGGAGAAGAAATGG - Intronic
1129658926 15:77542409-77542431 GAATTCAGGGGTTGGGGAAAAGG - Intergenic
1131146684 15:90018564-90018586 GAATTCACTGTCTAAAGAAACGG + Intronic
1131359047 15:91772974-91772996 GAAAACAGAGCGTGAAGAAAAGG - Intergenic
1134812187 16:17177156-17177178 GAATTAACTGGGTGAAAAAAAGG - Intronic
1134868227 16:17628154-17628176 GCATTAACTGGGTGAGGAAAAGG - Intergenic
1135132097 16:19861646-19861668 GTATTCTGTGTGTGGAGAAAAGG + Intronic
1135801128 16:25497283-25497305 AAATTGAGAGGGTGAACAAAAGG + Intergenic
1136595846 16:31249326-31249348 GAATACAGAGGTTGGAGAAAGGG - Intergenic
1136701204 16:32144488-32144510 GAAATCATTGAGGGAAGAAAAGG + Intergenic
1136766456 16:32782974-32782996 GAAATCATTGAGGGAAGAAAAGG - Intergenic
1136801642 16:33087404-33087426 GAAATCATTGAGGGAAGAAAAGG + Intergenic
1136924238 16:34356606-34356628 GAATGCAGTGGGAGACTAAAGGG + Intergenic
1136980335 16:35055200-35055222 GAATGCAGTGGGAGACTAAAGGG - Intergenic
1137045528 16:35655141-35655163 GGCTTCAATGGGTGCAGAAATGG - Intergenic
1138780959 16:59785338-59785360 GAACACAGTGGGTGGGGAAAAGG - Intergenic
1139580482 16:67870727-67870749 GAATTCAGTGGTAGGAGAAGAGG - Intronic
1140105350 16:71954905-71954927 TGATTCACTGGGTGCAGAAAAGG + Intronic
1140637216 16:76929324-76929346 GAATGCAGTGAGGGAAGAAACGG + Intergenic
1140948714 16:79795722-79795744 GAATTCGCCAGGTGAAGAAAGGG - Intergenic
1141601513 16:85129422-85129444 CCATTCTGTGGGTGAGGAAATGG - Intergenic
1203068845 16_KI270728v1_random:1045224-1045246 GAAATCATTGAGGGAAGAAAAGG - Intergenic
1144442158 17:15293243-15293265 GACTTCAGAAGGTGAACAAAAGG + Intergenic
1147376445 17:40025124-40025146 GAAGTCAGTGAGTCACGAAAAGG + Intronic
1147570967 17:41570820-41570842 GAACTGAGTGGCTGAATAAATGG + Intronic
1148370164 17:47093474-47093496 GAATTCAGTGGAGGAAAGAATGG + Intergenic
1149359614 17:55880413-55880435 GGAGTCAGAGGGTGAGGAAATGG + Intergenic
1149426662 17:56561376-56561398 GCATTCATTGGGGGAAAAAATGG + Intergenic
1150478707 17:65492950-65492972 ACATTCACTGCGTGAAGAAAGGG + Intergenic
1150861943 17:68809631-68809653 CAGTTCAGTGGATGAAGAAGAGG + Intergenic
1151130347 17:71890289-71890311 GAATTCAGTGGGAGAATTAGGGG - Intergenic
1151169237 17:72233011-72233033 GACATTAGTGGGTGAAGAGAGGG - Intergenic
1152500997 17:80708954-80708976 GAGTTCAGTGTGTGAAGAAACGG - Intronic
1153184147 18:2468451-2468473 TAATCCAGTGGGTGAGGAAATGG - Intergenic
1153263383 18:3245742-3245764 TAATTCAGTGGGGAAAGAAAAGG - Intergenic
1153273106 18:3342549-3342571 GAATTCAGTATGAGAAGTAAAGG - Intergenic
1153926177 18:9837039-9837061 AGATTCAGTGTGTGAAGAACGGG + Intronic
1155013598 18:21808650-21808672 GAATTCAGTAGGTCAATATATGG - Intronic
1156089874 18:33454485-33454507 GAATCCAGTGGAAGGAGAAAGGG + Intergenic
1157271015 18:46276267-46276289 GAAATCAGAGGTTGAAGAAGGGG + Intergenic
1157595363 18:48860775-48860797 GAATTCACTGGGTCATGGAAGGG + Exonic
1158298493 18:56026346-56026368 GATTTAAGTGAGTTAAGAAATGG + Intergenic
1158705361 18:59787914-59787936 GAAGACTGTGGGTGGAGAAAAGG - Intergenic
1158841304 18:61390826-61390848 GAATTCAGTGTGAGGAGTAAGGG - Intronic
1158911759 18:62070648-62070670 GAATGCATTTGGAGAAGAAAAGG + Intronic
1159277166 18:66235793-66235815 GAAGTCACTGGGAGAAAAAAAGG - Intergenic
1159681115 18:71353945-71353967 GACTCCAGTGGGTGAAAGAATGG - Intergenic
1161525829 19:4754529-4754551 GAATTCAGTGGGTTGACAAATGG + Intergenic
1161805545 19:6441234-6441256 GAATCCAGTGGGTGGAGTGAGGG + Exonic
1162526806 19:11210977-11210999 CAGGTGAGTGGGTGAAGAAATGG - Intronic
1162783756 19:13021496-13021518 GGTTTCAGTTGGGGAAGAAAGGG + Intronic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
1163173565 19:15549325-15549347 ACAATCAGTGGGTGAATAAATGG - Intronic
1165592536 19:36982391-36982413 CAATTCAATGGATGCAGAAAAGG - Intronic
1165838472 19:38773208-38773230 GAAATCAGTGGAAGAGGAAAGGG + Intronic
1165841087 19:38789489-38789511 GAAATCAGTGGAAGAGGAAAGGG - Intronic
1166730445 19:45056380-45056402 GAATTCAGTGGGGGAACACAAGG - Intronic
925188851 2:1867178-1867200 GAAGTCACTGAGTGGAGAAAAGG + Intronic
925324223 2:3004894-3004916 GTCTTCAGTGGGTTAAGAACAGG - Intergenic
927412658 2:22844753-22844775 GCCATCAGTGGATGAAGAAATGG - Intergenic
927419730 2:22917666-22917688 GAATTCTATAGGTAAAGAAATGG - Intergenic
927837822 2:26414970-26414992 GTATTCAATGTGTGGAGAAAGGG - Intronic
928029364 2:27765733-27765755 TGATTCAGTGGGTGGAGAATGGG - Intergenic
928050531 2:27989706-27989728 AAATTCAGTGGAGGGAGAAAGGG + Intronic
928670036 2:33593539-33593561 GAGTTCACTGGGTGAACCAAAGG + Intronic
929914006 2:46118649-46118671 GAATACAGAGCATGAAGAAATGG + Intronic
931013811 2:57951216-57951238 GACTTCAGTGGAGGAAGTAACGG + Intronic
931135963 2:59401294-59401316 CAATTCATTAGGTGCAGAAAAGG + Intergenic
931254840 2:60561365-60561387 GAATTCAATGAGTGACAAAAGGG + Intergenic
931580897 2:63772691-63772713 CAATTCAGTAGATGCAGAAAAGG + Intronic
931889094 2:66650179-66650201 AAATTCAGAGTGTGAAGAGATGG - Intergenic
932189223 2:69725038-69725060 GGAGTCAGAGGGAGAAGAAAAGG - Intronic
932362792 2:71122864-71122886 GAATTCCCTAGGTGAACAAAAGG - Intronic
932382844 2:71301376-71301398 CAATTGAGTGGTTGAAGAAATGG - Intronic
933460235 2:82573828-82573850 GCATTGAGTTGGGGAAGAAAAGG - Intergenic
933814771 2:86057225-86057247 GACTTCAGTGGAGGAAGTAATGG + Intronic
935494209 2:103758396-103758418 GAATTTAGTTGATGATGAAATGG - Intergenic
936008690 2:108911068-108911090 GAGTTCTGTGGGTGGAGAGAAGG + Exonic
936039878 2:109141931-109141953 GACTTCCGTGAGTGTAGAAAGGG - Intronic
936042341 2:109159451-109159473 GATTTTAGTGGGGGAAGAATTGG + Intronic
936273199 2:111068236-111068258 GCAGTCATTAGGTGAAGAAACGG + Intronic
938774143 2:134526200-134526222 GAAATCGATGGGAGAAGAAAAGG + Intronic
940603562 2:155891379-155891401 TAATGCAGTGGGTGAAAAGAAGG - Intergenic
940879057 2:158927917-158927939 TAATTCAGTGAGACAAGAAAAGG - Intergenic
941306313 2:163872718-163872740 TAATTCAGTGGGTAAATGAATGG - Intergenic
941306707 2:163878444-163878466 GAGTTAACTAGGTGAAGAAATGG + Intergenic
942921432 2:181378411-181378433 GCATTCAGTGGGTTGATAAATGG - Intergenic
943480498 2:188411472-188411494 GAGTCCACTGGGTGATGAAAGGG + Intronic
943641262 2:190361121-190361143 CAATGCAATGGGTGAAAAAAGGG + Intronic
944431951 2:199643783-199643805 AAATTCAGAGGTTGAAGACAAGG - Intergenic
944891585 2:204122970-204122992 GAATTGAAAGGGAGAAGAAAGGG - Intergenic
945249246 2:207750060-207750082 GAATGCAATGGGAGAGGAAAGGG - Intronic
945478317 2:210314009-210314031 GAACTCAGTGAATGAAGAGAAGG + Intronic
945672172 2:212815599-212815621 GGTTTCTGTGGGTGCAGAAATGG - Intergenic
946091165 2:217225262-217225284 GAAGTTAGTGGGAAAAGAAAGGG - Intergenic
1169304577 20:4477410-4477432 GAAATCAGTGGGTGAACAAATGG - Intergenic
1169328097 20:4693304-4693326 AAATTTAGTGGGACAAGAAAGGG - Intronic
1170387919 20:15840671-15840693 GAATTCCATGACTGAAGAAATGG + Intronic
1170451953 20:16491985-16492007 GAAGTCAGTGGGTGGGGAGAAGG - Intronic
1172433709 20:34913687-34913709 GGATTGAGTGAATGAAGAAAGGG - Intronic
1173960684 20:47069629-47069651 TAATTCAGTGGGGGAAGAAATGG + Intronic
1174469548 20:50746364-50746386 GAGATCATTGGCTGAAGAAAAGG + Intronic
1175167399 20:57054513-57054535 GCATTCAGCTGGTGACGAAATGG - Intergenic
1175584907 20:60131525-60131547 GCATCCAGTGGGGGAATAAAGGG + Intergenic
1177814570 21:25961855-25961877 GAATTCAGTGGCTCACGAAAAGG + Intronic
1178893546 21:36540714-36540736 GAATTCAGGGTGTGAGGAGAGGG + Intronic
1179817976 21:43920159-43920181 GCATGCAGTGGGGGAAGAAATGG - Intronic
1182052007 22:27320090-27320112 GGATTCAGTGGGTGGAGAGTGGG + Intergenic
1182052027 22:27320521-27320543 TAATTGAGTGGATGAATAAATGG - Intergenic
1182167317 22:28189004-28189026 GAACTCAGGGGGAAAAGAAAGGG + Intronic
1182319916 22:29471974-29471996 GTGTACAGTGGGTGAACAAATGG - Intergenic
1183040646 22:35175355-35175377 GATTTCACTGGATGAAGAAGTGG - Intergenic
949913296 3:8934026-8934048 CAATTCAGTGGGAGAAGGGATGG + Intronic
950334688 3:12183993-12184015 AAATTCAGTGGATGAAGCTATGG - Intronic
950340954 3:12243878-12243900 GACTTCACTGGATGAAGGAATGG + Intergenic
951153120 3:19316265-19316287 GCATTTAGTGGGTGGAGAACAGG - Intronic
951195662 3:19820596-19820618 GAATTCAGTGGAATCAGAAATGG - Intergenic
951532518 3:23711060-23711082 AAAATAAGTGGGGGAAGAAAGGG + Intergenic
951541100 3:23782938-23782960 GAATAAAGTGGGCAAAGAAAGGG + Intergenic
952005468 3:28837560-28837582 GAGGTCAGTGAGTGAAGAGAAGG - Intergenic
952175585 3:30859118-30859140 GAATGTAGGAGGTGAAGAAACGG + Intronic
952377486 3:32779860-32779882 GAATCCAGTGGTGGAACAAATGG - Intergenic
952641964 3:35607783-35607805 GAATATAGAGGGAGAAGAAATGG - Intergenic
952786326 3:37159240-37159262 TAATTCAGTGGGAGAAACAATGG - Intronic
953722281 3:45366909-45366931 CCATTCAGTGGAGGAAGAAATGG - Intergenic
954733065 3:52681761-52681783 GAAGCCAGTGGGAGAAGGAAGGG + Intronic
954980918 3:54744635-54744657 GACTCCTGTGGGTGAAGAATGGG - Intronic
955296139 3:57737012-57737034 AAATTCAGTGGTGGAAGCAATGG - Intergenic
955519507 3:59761375-59761397 GCATCCACTGGGTGAAGAAGGGG - Intronic
956116579 3:65925221-65925243 CAATTCAGTGGAAGAAGAAGTGG - Intronic
956418666 3:69061578-69061600 GAATTCAGTGGAAGATAAAATGG + Intronic
956423024 3:69104184-69104206 GATATCAGTGTGTGAAGGAAAGG + Intronic
956866869 3:73377672-73377694 GAATTCAGTGTGAAAAGACAGGG - Intergenic
956932341 3:74058980-74059002 GCAATCAGTGGGTGAAGTAAGGG + Intergenic
956950388 3:74275052-74275074 AAATTCAGAGCGTGAAGACAAGG + Intronic
957551244 3:81708210-81708232 AAATTCAGTATGTGATGAAAGGG + Intronic
957563537 3:81856074-81856096 GACCTCAGTGGTGGAAGAAATGG + Intergenic
957742386 3:84288292-84288314 GACTACAATGGGTGAAGTAAAGG + Intergenic
958902189 3:99900610-99900632 ATATTAAGTGTGTGAAGAAATGG - Intronic
959998207 3:112701115-112701137 GAATTCAGAGCTTGAAGACAAGG + Intergenic
961606248 3:128097555-128097577 GAATTCAGGTGGAGGAGAAAAGG - Intronic
961633154 3:128316435-128316457 GGATGCAGTGAGTGAAGAGAGGG - Intronic
961684428 3:128619520-128619542 GAATTCATTAGGTGGAGACAGGG + Intergenic
961802313 3:129461031-129461053 GAAAACAGTGGGTGAGGAGAAGG + Intronic
962011865 3:131399675-131399697 GCATCCAGTGGGTCAAGAGATGG + Intergenic
963100723 3:141601025-141601047 CAATTCAGTAGGGAAAGAAAAGG + Intronic
963491959 3:146013117-146013139 GCATTCTGTGAGTGAAGAGATGG - Intergenic
964315717 3:155442285-155442307 GAATTCAGTGAGTGACTAAAAGG - Intronic
966451734 3:180071016-180071038 CAAGTAAGTGAGTGAAGAAAAGG - Intergenic
967909364 3:194528363-194528385 GAGTTAATTAGGTGAAGAAAGGG - Intergenic
969073293 4:4557129-4557151 GACTTCAGTGGACCAAGAAATGG - Intergenic
971193314 4:24448013-24448035 GAATTCAGTGGTAGATGAGAAGG - Intergenic
971248936 4:24955713-24955735 GAATCCAGGGGAGGAAGAAATGG + Intronic
971441376 4:26691088-26691110 GACTTCAGTGGAGGAAGTAACGG + Intronic
971508079 4:27388175-27388197 AAATTCAGAAGGTGAAGGAAAGG - Intergenic
973667419 4:53177085-53177107 AAAATGAATGGGTGAAGAAAAGG - Intronic
973840778 4:54858236-54858258 GAACTGAGTTGCTGAAGAAAAGG + Intergenic
974133661 4:57787983-57788005 GTATTGAATGGGAGAAGAAATGG + Intergenic
975626830 4:76358637-76358659 GAATTCAGCAGGTGAAAAAGGGG - Intronic
976456989 4:85259393-85259415 GAGTAAAGTGGGAGAAGAAAGGG + Intergenic
977281500 4:95045576-95045598 GAATTCACTGGGTGAAGGGAAGG - Intronic
978016934 4:103755580-103755602 GACTTCTGGGGGTGATGAAAAGG - Intergenic
978082366 4:104609575-104609597 GACTTTAGTGGGGGAAGTAACGG - Intergenic
978357857 4:107896086-107896108 GAATTTATTGGGGGAAAAAAAGG - Intronic
979162339 4:117478950-117478972 GCATGCAGTGGCTGAGGAAATGG + Intergenic
979699284 4:123649468-123649490 AAATGCAGTGGGTGAAGAAAGGG - Intergenic
980186527 4:129469210-129469232 GGATTAAGTGAGTGAAGATAAGG + Intergenic
980235615 4:130101346-130101368 GTTTTTAGTGGCTGAAGAAATGG + Intergenic
981179227 4:141718963-141718985 ATATTCAGTGGCTGTAGAAATGG + Intronic
981252674 4:142623111-142623133 GAAATCAGAGGGAGAAGTAAAGG - Intronic
983561090 4:169102245-169102267 GAACCCACTGGGTGAAGCAATGG - Intronic
983876392 4:172881246-172881268 AAATTCAGTGGGTGAAAAATGGG + Intronic
984304633 4:177972673-177972695 GTCTTCAGTGGGGGAAGCAAGGG + Intronic
984612017 4:181851790-181851812 GAATTCAGAGGATGATGAAAAGG - Intergenic
984726870 4:183029973-183029995 CAATTCATTGAGTAAAGAAAAGG - Intergenic
985818184 5:2142059-2142081 GAAATCAGTGGATGAAGCACAGG + Intergenic
986275185 5:6268376-6268398 AAATCCAGTGGGTGAGGGAAGGG + Intergenic
987227483 5:15858404-15858426 GTATTCATTGGATGAAAAAAAGG + Intronic
990504292 5:56429431-56429453 GAATGCAGTTGCTGAAGAGATGG + Intergenic
990546376 5:56825810-56825832 TCATTCTGAGGGTGAAGAAAAGG - Intronic
990872090 5:60443232-60443254 GACCTCAGTGTATGAAGAAAAGG + Intronic
991431884 5:66556624-66556646 CAATTCAGTGGGGGAAAAATAGG - Intergenic
991565326 5:67998721-67998743 GAACACAGTGGGTGATGACAGGG - Intergenic
992750402 5:79856042-79856064 GATTTTAGTGGGTGAAGGGATGG + Intergenic
994208098 5:97058665-97058687 AAATTCAGAGTTTGAAGAAAAGG - Intergenic
996037460 5:118774201-118774223 GAATTCAGTGAGTTAACATAGGG + Intergenic
996391160 5:122963440-122963462 GAAGTCTGAGTGTGAAGAAAAGG - Intronic
997083508 5:130768848-130768870 AAAATCAGTGGGTCAAGAGAAGG + Intergenic
997500421 5:134369519-134369541 GAATTCAGGGTTTGAAGAAAGGG - Intronic
997581004 5:135016987-135017009 GAAATCAGTGTGTGCAGAAAGGG + Intergenic
999402120 5:151273370-151273392 GAATTAAGCAGGTGAAGAGATGG + Intergenic
999562802 5:152823643-152823665 GTATTCAGGGGGTAAGGAAAAGG + Intergenic
999948572 5:156624200-156624222 GATTTCAGTGGGTGAAGTTGGGG + Intronic
1000839215 5:166195782-166195804 TCATTCAGCTGGTGAAGAAAGGG - Intergenic
1002111748 5:176919747-176919769 CAATTCAGTGGGGGAAAACAAGG - Intronic
1002388054 5:178885513-178885535 GAATTGAGTGGGTGGAGAAGAGG + Intronic
1003447561 6:6198940-6198962 GAATTTAGGAGGTCAAGAAAAGG + Intronic
1003737662 6:8895177-8895199 GATTTCAGTGGTGTAAGAAATGG - Intergenic
1003768934 6:9275170-9275192 GAATAAAGTGGGAAAAGAAAAGG - Intergenic
1004040257 6:11968165-11968187 GAAGTTAGTGGGGGAAGAATTGG + Intergenic
1004223293 6:13765269-13765291 GAATTCAGTAGGTCCAGAGAAGG - Intergenic
1004517981 6:16336797-16336819 GACTGCAGTGGGTCAAGCAAAGG + Intronic
1005157587 6:22824346-22824368 GTATTCAGTGGGTTAGGAGATGG - Intergenic
1005669375 6:28089738-28089760 GATTACAGTGTGGGAAGAAAAGG + Intergenic
1006287149 6:33105315-33105337 GAAGTGAGTGGGTGAGGAGATGG + Intergenic
1006786002 6:36667677-36667699 TAATTCAGTGGGTTGAGATAGGG + Intergenic
1006938146 6:37732767-37732789 GAGAACAGTGGGGGAAGAAATGG - Intergenic
1007157138 6:39756397-39756419 CAAATGAGTGGGTAAAGAAAAGG - Intergenic
1008015090 6:46509565-46509587 AAAATGAGTGAGTGAAGAAATGG - Intergenic
1009581409 6:65538838-65538860 GAATGCAGTGAGTGAAGGCAGGG - Intronic
1009838264 6:69032666-69032688 GAATTCAGTGAAGGAAGCAAAGG - Intronic
1010510765 6:76716641-76716663 ACATTCAGAGGTTGAAGAAAAGG - Intergenic
1010635424 6:78253644-78253666 GAATTAAAGAGGTGAAGAAATGG - Intergenic
1010649194 6:78431231-78431253 GATTTCAGTGACAGAAGAAATGG - Intergenic
1011584471 6:88909408-88909430 TAATGCAGTGGGTCAAGCAAGGG - Intronic
1011698569 6:89934722-89934744 CAATGAAGTGGATGAAGAAAAGG + Intronic
1011820733 6:91250464-91250486 GAATTCTGTAGTGGAAGAAATGG - Intergenic
1012028440 6:94028058-94028080 AAATTCAGAGGGTCAGGAAATGG - Intergenic
1012445709 6:99305122-99305144 GAATTCAGCTTGTGGAGAAAAGG + Intronic
1012473609 6:99597564-99597586 GCATCCAGTGGGTGGAGACAAGG + Intergenic
1014309530 6:119782782-119782804 AAATCCAGTGGTAGAAGAAATGG + Intergenic
1014766022 6:125407709-125407731 GGATACACTGGGTGAAGGAAAGG - Intergenic
1015302652 6:131671459-131671481 GAATTCAGGCTGTGAAGGAATGG + Intronic
1018559759 6:165089368-165089390 GAATCCAGAAGGTGAAGTAAGGG - Intergenic
1020706748 7:11553430-11553452 TAATTCAGTGAATGAAGTAAAGG + Intronic
1022140335 7:27487938-27487960 GACTTTAGGGGGTCAAGAAATGG - Intergenic
1023193092 7:37604150-37604172 GAAGTCACTGAGAGAAGAAAAGG - Intergenic
1023309370 7:38868184-38868206 ATATTCAATGAGTGAAGAAAAGG + Intronic
1023770892 7:43555765-43555787 GAACTGAGTGGGTGAAGCCAGGG - Intronic
1024085162 7:45886559-45886581 AAATTCAGAAGGTTAAGAAAGGG + Intergenic
1027645109 7:80787720-80787742 GGATTCAGTGGAGGATGAAATGG + Intronic
1028563974 7:92207042-92207064 GATTTTAGAGGGAGAAGAAATGG + Intronic
1029693806 7:102200182-102200204 GAAGACAGTGGATGAAGAAATGG - Intronic
1029812974 7:103068010-103068032 GAGATAAGTGGATGAAGAAATGG + Intronic
1030399147 7:109026744-109026766 GAATTCTGAGGCAGAAGAAAGGG + Intergenic
1030825580 7:114153305-114153327 GATTGCTGTGGGGGAAGAAAAGG + Intronic
1031639306 7:124142124-124142146 CATTTCAGTGAATGAAGAAATGG - Intergenic
1031900056 7:127398903-127398925 GAATTCCATGGGGGAAAAAAGGG + Intronic
1032455326 7:132068922-132068944 GAATACAGTAGATGAAGAAGAGG - Intergenic
1032659877 7:133970905-133970927 GAAGTCAGTAGATGAAGAAAAGG - Intronic
1033347965 7:140540221-140540243 GATTTCTGTGGGAGAAGAGAAGG - Intronic
1034855059 7:154537349-154537371 CAATACAGTGGGTGTAAAAATGG - Intronic
1037244633 8:16819002-16819024 CAATTGAGTGGGGGAATAAATGG + Intergenic
1037667413 8:20982026-20982048 AAATTCAGTGAGTGAAAGAAGGG + Intergenic
1039903770 8:41771539-41771561 GAATTGATGGGCTGAAGAAAAGG + Intronic
1040807249 8:51408418-51408440 GCATTCAGTCGGTAAAGAATAGG + Exonic
1042373114 8:68015560-68015582 GAGTTCAGTTTATGAAGAAAAGG + Intronic
1042506957 8:69571055-69571077 GGAGTCAGTGTGTGTAGAAAAGG + Intronic
1042984595 8:74569010-74569032 GAATACTGTAGGTAAAGAAAAGG - Intergenic
1044620211 8:94183450-94183472 AAATTCAGTGGGGGAAAGAATGG + Intronic
1045092961 8:98766069-98766091 GAGTTAATTGGGTGAAGAAATGG - Intronic
1045195965 8:99930862-99930884 GAACTCAGTTGGAGAAGAAAAGG + Intergenic
1045728622 8:105206141-105206163 GAATAGAGAGGCTGAAGAAAAGG + Intronic
1046637356 8:116685357-116685379 GTATTCTGTGGCTGAAGAACAGG - Intronic
1046760250 8:118012989-118013011 GCATAATGTGGGTGAAGAAAAGG + Intronic
1047249620 8:123171827-123171849 GTTTGCTGTGGGTGAAGAAACGG + Intergenic
1047625498 8:126652090-126652112 AATTTGAGTGGCTGAAGAAATGG + Intergenic
1047803045 8:128330172-128330194 GAAGTCAGTGGGTGAACACAAGG + Intergenic
1048169944 8:132096741-132096763 TAAATCAGATGGTGAAGAAAGGG + Intronic
1048325159 8:133433327-133433349 GAATTCTGTGGGTCAGGAACTGG - Intergenic
1050314647 9:4388941-4388963 GAAGTCAGAAAGTGAAGAAAAGG + Intergenic
1050733054 9:8731549-8731571 TATTTCAGTGTTTGAAGAAAAGG + Intronic
1050949761 9:11573446-11573468 GTATTCAGTGGGAGAGGAAAGGG - Intergenic
1051663591 9:19447238-19447260 GAATTCTAGTGGTGAAGAAATGG + Intronic
1051730782 9:20140626-20140648 AAATTCAGGGGGTGCAGAACAGG - Intergenic
1052436922 9:28441926-28441948 GAAAACAGTGGGTGAAGTTAGGG - Intronic
1053754495 9:41290907-41290929 GAATTCAGTGGGGGATGGAGAGG + Intergenic
1054260013 9:62855242-62855264 GAATTCAGTGGGGGATGGAGAGG + Intergenic
1054787655 9:69224223-69224245 GAATTCAGTGGGTGAAGAAAAGG - Intronic
1055388872 9:75796710-75796732 GAATTGAGAGGATGAAGATAAGG - Intergenic
1055746468 9:79451214-79451236 GAGTTCAATGGGTGAAGTACAGG - Intergenic
1057325134 9:94055875-94055897 GCATTCTGTGGGTTTAGAAAAGG - Intronic
1057893568 9:98888330-98888352 GTTTTCAGTGGCTGAGGAAAAGG - Intergenic
1057960896 9:99455844-99455866 GAATTCAATGGGAGAAGAGTAGG - Intergenic
1058631572 9:106993633-106993655 GAATGCAGGGAGTGAAGGAAGGG - Intronic
1058843215 9:108931259-108931281 TGATTCAGGGGGTGAAGAAGTGG + Intronic
1059919353 9:119140659-119140681 AAATTAAGTGAGTGAATAAATGG - Intergenic
1062151143 9:135019672-135019694 GGCATCACTGGGTGAAGAAATGG + Intergenic
1185770066 X:2759192-2759214 GCATTCGGTGGGTGGAGACAAGG + Intronic
1186502585 X:10064157-10064179 GCATTCAGTGGGTGTAGACCAGG + Intronic
1187051092 X:15696264-15696286 GGATACAGTGGGGGATGAAAGGG - Intronic
1187090404 X:16090189-16090211 TAATTCGGGGGGTGAAGAGAAGG - Intergenic
1187426146 X:19178990-19179012 GAAATCGGTGGGTAAAAAAATGG + Intergenic
1187614252 X:20975962-20975984 TGCTTCAGTGGGGGAAGAAAGGG - Intergenic
1187773476 X:22729585-22729607 AAATTCAGAGCTTGAAGAAAAGG - Intergenic
1188337352 X:28953303-28953325 GATTTCCCTGGGAGAAGAAATGG + Intronic
1188659706 X:32743663-32743685 GTGTTCAGTGGGTGAGGAATGGG + Intronic
1188795976 X:34465756-34465778 GAGTTCAATGGATGAAAAAAAGG + Intergenic
1189095141 X:38130492-38130514 GAATTCTGTGGCTGAAGAGAAGG - Intronic
1189407002 X:40734537-40734559 AATTTCAGTGTGTGAAGAAAAGG - Intronic
1189964387 X:46356992-46357014 GGATAGAGTGGGGGAAGAAATGG - Intergenic
1190093251 X:47458355-47458377 GAATTTATTGGATTAAGAAATGG + Intronic
1190373452 X:49765109-49765131 AAAGGCAGTGGGTGAAAAAATGG + Intergenic
1190725383 X:53187065-53187087 GAATCCATTGGGCAAAGAAAAGG - Intergenic
1191660256 X:63642145-63642167 GAATACAGTGGGGGAAGTAGAGG + Intronic
1191838357 X:65489563-65489585 AACTTCAGTGGAAGAAGAAAAGG - Intronic
1192068951 X:67917159-67917181 AAATTCAGAGCTTGAAGAAAAGG - Intergenic
1192268492 X:69556608-69556630 GAATTCAGTGAGTGCTGTAAAGG + Intergenic
1192427063 X:71086777-71086799 GTAGTCAGTGGGTGGAGAAAGGG - Intergenic
1193198363 X:78659344-78659366 GAGTTCAGTGTGTGCAGAAAAGG - Intergenic
1193420609 X:81278539-81278561 GAATTAAGTGGATGCAGAGAAGG - Intronic
1193882608 X:86942566-86942588 GAAGTCAGAGGGGGAAAAAAGGG + Intergenic
1194262491 X:91714822-91714844 GAATTCTGTGGCTGAGGCAAAGG - Intergenic
1194276184 X:91885596-91885618 TAGTTCAGTGTGTGCAGAAAAGG - Intronic
1196097761 X:111817871-111817893 GAATTCAGTGGGATAATAACTGG + Intronic
1196560203 X:117137426-117137448 GAAGACATTGGGTGGAGAAAAGG + Intergenic
1197362661 X:125525855-125525877 GATTTCAGGGGCTGAAGATAAGG - Intergenic
1197442283 X:126507224-126507246 GTCTTCAGTGACTGAAGAAAAGG - Intergenic
1197830994 X:130642245-130642267 GACTTCAGTGGAGGAAGTAATGG + Intronic
1199167580 X:144695476-144695498 GACTTCAGGGTGAGAAGAAAAGG + Intergenic
1200581782 Y:4959712-4959734 GAATTCTGTGGCTGAGGCAAAGG - Intergenic
1200593432 Y:5107050-5107072 TAGTTCAGTGTGTGCAGAAAAGG - Intronic