ID: 1054788611

View in Genome Browser
Species Human (GRCh38)
Location 9:69234086-69234108
Sequence CTGTGAGTCTCTCACAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 847
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 819}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054788611_1054788617 24 Left 1054788611 9:69234086-69234108 CCACCTCTGTGAGAGACTCACAG 0: 1
1: 0
2: 1
3: 26
4: 819
Right 1054788617 9:69234133-69234155 CAAGAAATTCTATTGTGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054788611 Original CRISPR CTGTGAGTCTCTCACAGAGG TGG (reversed) Intronic
901386491 1:8912736-8912758 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
901970476 1:12903622-12903644 TTGGGTGTTTCTCACAGAGGGGG - Intronic
902014689 1:13298147-13298169 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
902019203 1:13330040-13330062 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
903100551 1:21024854-21024876 TTGGGTGTTTCTCACAGAGGGGG - Intronic
903148697 1:21389718-21389740 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
903508345 1:23854027-23854049 TTGGGTGTTTCTCACAGAGGGGG - Intronic
903524934 1:23986568-23986590 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
903525745 1:23992750-23992772 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
903634460 1:24801027-24801049 TTGGGTGTTTCTCACAGAGGGGG - Intronic
903921268 1:26802931-26802953 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
904078128 1:27855047-27855069 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
904795519 1:33053430-33053452 TTGGGTGTTTCTCACAGAGGGGG - Intronic
905094947 1:35462167-35462189 CTGTGAGTGTCTCCAGGAGGCGG + Intronic
905495775 1:38384652-38384674 CTGGAAGTCTCTTAAAGAGGGGG - Intergenic
905598931 1:39233820-39233842 TTGGGTGTTTCTCACAGAGGGGG + Intronic
905699503 1:40000580-40000602 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
905748227 1:40437584-40437606 CTGTAAGTCTCTCAAAGAAAAGG + Intergenic
906041505 1:42791160-42791182 CTGTCAGTTTCTGATAGAGGGGG - Intronic
906353391 1:45082290-45082312 TTGGGTGTTTCTCACAGAGGGGG - Intronic
906400110 1:45498344-45498366 TTGGGTGTTTCTCACAGAGGGGG - Intronic
906487482 1:46242898-46242920 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
907286087 1:53380691-53380713 CAGTGATTCCCTCACAGTGGTGG - Intergenic
907402709 1:54234310-54234332 TTGGGTGTTTCTCACAGAGGGGG - Intronic
907453307 1:54561133-54561155 TTGGGTGTTTCTCACAGAGGGGG + Intronic
908590758 1:65630377-65630399 TTGGGTGTTTCTCACAGAGGGGG - Intronic
908749081 1:67402340-67402362 CTGTAAGCCTTTCATAGAGGTGG - Intergenic
909988381 1:82191046-82191068 CTGTGGGTCTCCCATAGTGGTGG - Intergenic
910344232 1:86217281-86217303 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
910398259 1:86812882-86812904 GTGTAAGTATCTCACAGAAGTGG - Intergenic
910406682 1:86898815-86898837 TTGGGTGTTTCTCACAGAGGGGG + Intronic
910673605 1:89797234-89797256 TTGGGTGTTTCTCACAGAGGGGG + Intronic
911325695 1:96469128-96469150 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
912284801 1:108357806-108357828 CTGTGAGGCTCCCACAGAGCTGG + Intergenic
912297957 1:108488378-108488400 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
912317189 1:108676663-108676685 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
912690377 1:111800505-111800527 TTGGGTGTTTCTCACAGAGGGGG - Intronic
912790146 1:112641185-112641207 TTGGGTGTTTCTCACAGAGGGGG - Intronic
912808462 1:112774924-112774946 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
912824994 1:112897656-112897678 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
912845446 1:113071096-113071118 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
912939100 1:114029454-114029476 CTGTGAGTGCCTCATAAAGGAGG - Intergenic
913020996 1:114789992-114790014 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
913305668 1:117428833-117428855 TTGGGTGTTTCTCACAGAGGGGG + Intronic
914467886 1:147948791-147948813 TTGGGTGTTTCTCACAGAGGGGG + Intronic
914774900 1:150727979-150728001 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
914780782 1:150782489-150782511 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
914908846 1:151768697-151768719 TTGGGTGTTTCTCACAGAGGGGG + Intronic
914915620 1:151817473-151817495 CTGTGTTTGTTTCACAGAGGAGG + Intronic
914953784 1:152144171-152144193 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
914959656 1:152195502-152195524 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
915411151 1:155701642-155701664 TTGGGTGTTTCTCACAGAGGGGG - Intronic
915632175 1:157161094-157161116 CTGTTGGGCTCTCACAGAGAAGG - Intergenic
916131522 1:161615987-161616009 TTGGGTGTTTCTCACAGAGGGGG + Intronic
917006381 1:170419843-170419865 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
917206175 1:172572663-172572685 TTGGGTGTTTCTCACAGAGGGGG - Intronic
917304837 1:173614232-173614254 TTGGGTGTTTCTCACAGAGGGGG - Intronic
917375453 1:174348489-174348511 TTGGGTGTTTCTCACAGAGGGGG + Intronic
918228425 1:182508717-182508739 TTGGGTGTTTCTCACAGAGGGGG + Intronic
920391921 1:205610444-205610466 TTGTAAGTTTCTCAAAGAGGAGG - Exonic
920451821 1:206065240-206065262 TTGGGTGTTTCTCACAGAGGGGG - Intronic
920725966 1:208435566-208435588 CTGTGAGTCTCATATAGAGGGGG + Intergenic
920749312 1:208658967-208658989 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
920795190 1:209130167-209130189 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
921016666 1:211197966-211197988 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
921198517 1:212780467-212780489 TTGGGTGTTTCTCACAGAGGGGG - Intronic
921237612 1:213150344-213150366 TTGGGTGTTTCTCACAGAGGGGG + Intronic
921413898 1:214868631-214868653 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
921845273 1:219872839-219872861 TTGGGTGTTTCTCACAGAGGGGG + Intronic
921902501 1:220465714-220465736 CTGGGTGTTTCTCGCAGAGGGGG + Intergenic
922234766 1:223713980-223714002 CTTTCAGTCTCTCAAAGAGCCGG + Intronic
923259307 1:232252051-232252073 CTGTGTCCCTCTCACAGATGAGG + Intergenic
923590106 1:235310141-235310163 TTGGGTGTTTCTCACAGAGGGGG - Intronic
923711191 1:236387963-236387985 TTGGGTGTTTCTCACAGAGGGGG - Intronic
923792820 1:237126815-237126837 TTGGGTGTTTCTCACAGAGGGGG + Intronic
924178386 1:241416202-241416224 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
924692421 1:246363885-246363907 TTGGGTGTTTCTCACAGAGGGGG - Intronic
924824312 1:247522876-247522898 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1063144105 10:3280733-3280755 CTGTACGTCCATCACAGAGGTGG + Intergenic
1064663341 10:17628383-17628405 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1065012377 10:21431163-21431185 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1065336541 10:24658014-24658036 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1065594091 10:27295592-27295614 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1065756380 10:28934823-28934845 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1065840656 10:29697760-29697782 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1065983973 10:30930975-30930997 CCGTGAGGGTCTCACAGAGTAGG - Intronic
1067026686 10:42848289-42848311 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1067325418 10:45260939-45260961 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1068815052 10:61300206-61300228 GTGTGAGTATCTCCCAGAGCTGG - Intergenic
1069740839 10:70686316-70686338 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1070317750 10:75332506-75332528 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1070683832 10:78467539-78467561 CTGTGAACCAGTCACAGAGGTGG + Intergenic
1071138350 10:82478284-82478306 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1071616809 10:87081911-87081933 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1072013191 10:91322539-91322561 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1072117442 10:92377396-92377418 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1072149409 10:92673761-92673783 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1072648934 10:97277560-97277582 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1072705425 10:97677396-97677418 GTGTGAGTCTGTCACAGAAGGGG - Intergenic
1072949179 10:99837503-99837525 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1072956677 10:99892721-99892743 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1072980689 10:100094508-100094530 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1073000201 10:100278776-100278798 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1073386621 10:103130518-103130540 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1073594407 10:104785545-104785567 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1073951021 10:108809382-108809404 CTTTGAGTGGCCCACAGAGGAGG - Intergenic
1074944092 10:118264485-118264507 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1075000806 10:118795699-118795721 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1075061512 10:119260436-119260458 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1075129055 10:119723038-119723060 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1075258117 10:120941043-120941065 CTGTACGCCTCACACAGAGGAGG + Intergenic
1075278142 10:121113663-121113685 CTGTGGGTCTCTCAGAGCAGAGG - Intergenic
1075842913 10:125519141-125519163 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1075994905 10:126869360-126869382 CTGTGATTCTATCAAAGAGCCGG - Intergenic
1076637238 10:131890050-131890072 CTGTTGGTCTCTCACAGGGGAGG + Intergenic
1077123332 11:921106-921128 CTGTGATCCTCTCCCATAGGAGG - Intergenic
1077397775 11:2333435-2333457 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1077577851 11:3398037-3398059 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1077668387 11:4136800-4136822 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1078523219 11:12080370-12080392 CTGTGAGTTTCCCCAAGAGGCGG + Intergenic
1079039554 11:17049632-17049654 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1080098469 11:28431743-28431765 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1080599254 11:33806700-33806722 ATGTGAGACTTTGACAGAGGGGG - Intergenic
1081289380 11:41305867-41305889 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1081456637 11:43229701-43229723 CTTTGATTCTCAAACAGAGGAGG - Intergenic
1081716944 11:45257241-45257263 CTTTGAGTCTCTCAAATAGGAGG - Intronic
1081784485 11:45737557-45737579 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1081956655 11:47098270-47098292 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1082232965 11:49791774-49791796 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1082936072 11:58658284-58658306 CTGTGAGGCTCTTACAGAGAGGG - Intronic
1083079052 11:60072547-60072569 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1083090915 11:60200321-60200343 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1083115220 11:60452358-60452380 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1083119040 11:60492370-60492392 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1083131174 11:60623609-60623631 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1083154897 11:60816320-60816342 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1083338473 11:61942421-61942443 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1083382820 11:62280258-62280280 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1083645533 11:64170782-64170804 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1083832263 11:65240266-65240288 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1084049317 11:66589058-66589080 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1084140118 11:67222104-67222126 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1084863772 11:72039801-72039823 ATGTGAGTGTCTCTCAGATGGGG - Intronic
1084924446 11:72501544-72501566 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1085073926 11:73572839-73572861 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1085083488 11:73651889-73651911 CTGTGAGTCACTCCCAGGAGAGG + Exonic
1085116336 11:73935637-73935659 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1085359764 11:75876879-75876901 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1085512916 11:77097501-77097523 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1085534643 11:77210771-77210793 CTGAGAGGCTCTTCCAGAGGAGG + Intronic
1085563418 11:77491092-77491114 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1085754690 11:79192712-79192734 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1086061869 11:82708206-82708228 CTGTTACCCTCTCAAAGAGGAGG + Intergenic
1086288526 11:85277615-85277637 CTGTGAGTAACTCACAGAGCTGG - Intronic
1086447219 11:86880409-86880431 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1087056949 11:93946118-93946140 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1087198032 11:95320260-95320282 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1087710828 11:101548488-101548510 CTCTCTGTCTCTCACAGATGAGG + Intronic
1087948899 11:104195590-104195612 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1088588630 11:111381073-111381095 CTGTGAGACACTCACAGAACTGG - Intronic
1088809976 11:113385689-113385711 CTCTGAATTTCTCACAGGGGTGG - Intergenic
1089420563 11:118330316-118330338 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1090060831 11:123462845-123462867 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1090181713 11:124705297-124705319 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1090323483 11:125864640-125864662 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1090790584 11:130090294-130090316 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1091762171 12:3094901-3094923 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1092331147 12:7589207-7589229 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1092447068 12:8567822-8567844 CTCTGAAGCTCTCACAGAGAAGG + Intergenic
1092827257 12:12412937-12412959 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1094302800 12:28984843-28984865 CTGTAGGTCTGTCAGAGAGGAGG + Intergenic
1095440064 12:42229375-42229397 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1096021815 12:48331732-48331754 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1096039178 12:48499757-48499779 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1096041261 12:48519838-48519860 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1096092870 12:48915142-48915164 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1096185055 12:49573721-49573743 CTGTGATTCTCTTACCTAGGGGG - Intronic
1096856408 12:54487512-54487534 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1097028338 12:56075126-56075148 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1097779691 12:63687548-63687570 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1098379323 12:69852618-69852640 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1098717727 12:73853245-73853267 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1098884173 12:75943350-75943372 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1099957962 12:89369707-89369729 CTGTAAGTCTCCCCCAGAAGCGG + Intergenic
1100353961 12:93811250-93811272 CTGTGAATCTGGCACAGAGCAGG - Intronic
1100582604 12:95949094-95949116 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1100845571 12:98654860-98654882 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1100994825 12:100293559-100293581 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1101317766 12:103644495-103644517 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1101393248 12:104322834-104322856 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1101562708 12:105873751-105873773 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1102089565 12:110173928-110173950 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1102174473 12:110866349-110866371 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1102293716 12:111722417-111722439 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1102578935 12:113873643-113873665 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1103234289 12:119359564-119359586 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1103299565 12:119917836-119917858 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1103591632 12:121994921-121994943 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1104499829 12:129274422-129274444 TTCTGAGTCTTTTACAGAGGTGG + Intronic
1104861322 12:131925766-131925788 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1105291266 13:19055251-19055273 CTGTGGGATTCTCACTGAGGAGG - Intergenic
1105368251 13:19780774-19780796 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1105526835 13:21185747-21185769 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1105556285 13:21449181-21449203 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1106104982 13:26724780-26724802 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1106885732 13:34182089-34182111 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1107166101 13:37281352-37281374 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1107650330 13:42538488-42538510 CTGAGATTCTCCCACAGAAGGGG + Intergenic
1107692612 13:42967243-42967265 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1107953126 13:45484631-45484653 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1108059030 13:46514926-46514948 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1108330726 13:49379659-49379681 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1108351713 13:49594187-49594209 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1110264202 13:73519485-73519507 CAGGGAGTCTCTCCCTGAGGCGG + Intergenic
1112590715 13:100761541-100761563 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1114225944 14:20738731-20738753 CAGAGAGTATCTCACAGAGGTGG + Intronic
1114428429 14:22639948-22639970 TTGGGTGTTTCTCACAGAGGAGG - Intergenic
1114694758 14:24616292-24616314 CTGTGAGTCTCACACAGAAAAGG - Intergenic
1115504443 14:34079751-34079773 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1115610064 14:35040222-35040244 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1115847349 14:37554682-37554704 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1116342743 14:43745995-43746017 CTGTGGGTCACACACAGAAGTGG - Intergenic
1116480889 14:45390793-45390815 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1116871827 14:50074875-50074897 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1116877367 14:50125803-50125825 CTGCCAGTCTCCTACAGAGGTGG - Intronic
1116957921 14:50943533-50943555 CCGTGAGTCTTTCGCAAAGGCGG - Intronic
1117024360 14:51605170-51605192 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1117716783 14:58589112-58589134 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1118148947 14:63166785-63166807 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1118184423 14:63523672-63523694 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1118517294 14:66544619-66544641 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1118584863 14:67342147-67342169 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1119254076 14:73183328-73183350 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1119405065 14:74393466-74393488 CTCTGAGCCACCCACAGAGGAGG + Intergenic
1120309666 14:82813685-82813707 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1121306447 14:92910743-92910765 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1121319240 14:92981466-92981488 CTGTGGGGCTCTCGCGGAGGTGG - Intronic
1121738605 14:96236007-96236029 CTGTGCTTGCCTCACAGAGGAGG - Intronic
1122263154 14:100534640-100534662 CTGTGGGCCTCTCAGAGGGGAGG - Intergenic
1122300968 14:100730900-100730922 GTGTGGGTCTCTCTGAGAGGGGG + Intronic
1122528845 14:102410424-102410446 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1122957625 14:105078632-105078654 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1122963431 14:105110813-105110835 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1124246060 15:28071126-28071148 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1124432076 15:29616441-29616463 GTGTGACTGTCTCACAGAGCAGG - Intergenic
1124614984 15:31235033-31235055 CTCAGAGTCTCTCACACAGTAGG - Intergenic
1124797577 15:32797120-32797142 TTGTGAGTCTGTCATAGAGGTGG - Intronic
1125079665 15:35657534-35657556 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1125475725 15:40046949-40046971 CTGTGGGTCTGTCACAGAGGTGG - Intergenic
1125659675 15:41383998-41384020 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1125727107 15:41873760-41873782 CTGTGGGACTCTCAGGGAGGCGG - Intronic
1127073427 15:55304426-55304448 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1127850818 15:62910382-62910404 CTGTGGGTCCCTCACAGAAGAGG + Intergenic
1128071164 15:64798452-64798474 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1128938767 15:71769880-71769902 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1128970723 15:72102449-72102471 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1129428807 15:75482741-75482763 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1130340503 15:82997254-82997276 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1130447580 15:84017816-84017838 CTGTGAGCTTCTCAAGGAGGAGG - Intronic
1130946032 15:88551754-88551776 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1131001063 15:88940779-88940801 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1131125765 15:89855490-89855512 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1131127747 15:89869534-89869556 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1131438472 15:92441125-92441147 TTGTGTTTCTCCCACAGAGGAGG - Intronic
1132730556 16:1359191-1359213 ATGTGAGTCTCTTACATACGTGG + Intronic
1132744526 16:1431208-1431230 CTGGGGGTCTCTCCCAGGGGTGG - Intergenic
1132777109 16:1600416-1600438 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1132894041 16:2219366-2219388 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1132992092 16:2801371-2801393 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1133751859 16:8732252-8732274 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1134030357 16:10987470-10987492 TTGTGTGTCTCTCACAAGGGAGG - Intronic
1134073793 16:11276561-11276583 CTGTGCTGCCCTCACAGAGGAGG - Intronic
1134854030 16:17505044-17505066 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1135026661 16:19003995-19004017 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1135639438 16:24108383-24108405 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1135771631 16:25222321-25222343 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1136160892 16:28417780-28417802 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1136202074 16:28697220-28697242 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1136426471 16:30170873-30170895 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1136583529 16:31169300-31169322 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1136668783 16:31837368-31837390 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1137244783 16:46693890-46693912 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1137284150 16:47001252-47001274 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1137493719 16:48952707-48952729 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1137551510 16:49440707-49440729 CCGTGACTCTCTCTCAGAGGTGG - Intergenic
1137867392 16:51914727-51914749 CTCTGAGTCTCTCAGAGCTGAGG + Intergenic
1138043751 16:53699353-53699375 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1139771316 16:69279892-69279914 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1139885804 16:70205917-70205939 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1140994575 16:80244772-80244794 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1141063598 16:80896849-80896871 CTGTGATTCTCTCAGGGATGTGG - Intergenic
1141207261 16:81942380-81942402 CTGAGAGTATCTCACAGTCGGGG - Intronic
1141545817 16:84767809-84767831 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1141707752 16:85677767-85677789 TTTAGACTCTCTCACAGAGGTGG - Exonic
1141772962 16:86101994-86102016 CTTTCAGCCTCTCACAGATGGGG - Intergenic
1141896254 16:86960468-86960490 CTGTCACTCTCTTACAAAGGAGG - Intergenic
1142530008 17:572992-573014 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1142533869 17:599715-599737 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1142704856 17:1688606-1688628 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1142949478 17:3465743-3465765 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1142963098 17:3563712-3563734 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1143153968 17:4823986-4824008 CTGTGAGTCTAGAACAGAGCTGG - Intergenic
1143395910 17:6596055-6596077 CTGTGTGACTCTAACAGATGAGG + Intronic
1143689799 17:8551104-8551126 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1144238654 17:13287725-13287747 CTGTGATTCCCACACAGAGGTGG - Intergenic
1144482296 17:15638211-15638233 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1144524483 17:15979019-15979041 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1144716752 17:17441693-17441715 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1144798833 17:17911685-17911707 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1144860609 17:18299017-18299039 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1144934575 17:18887877-18887899 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1145022457 17:19442372-19442394 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1145047025 17:19627154-19627176 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1145206380 17:20986162-20986184 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1145418344 17:22742151-22742173 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1145717414 17:27034789-27034811 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1145863269 17:28225242-28225264 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1145895503 17:28455441-28455463 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1146744219 17:35313830-35313852 CTGTGGGTCTTTCACCGGGGAGG + Intergenic
1147024344 17:37566598-37566620 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1147109863 17:38253984-38254006 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1147220318 17:38925050-38925072 CTATGAGTCTTTCATAGATGGGG - Intergenic
1147660189 17:42113183-42113205 CTGTCAGTCTCCCCCAGGGGTGG - Exonic
1147785279 17:42973957-42973979 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1148208884 17:45796314-45796336 CTGTTTGGCTCTCACAGAAGAGG - Intronic
1148267399 17:46237609-46237631 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1148633046 17:49126463-49126485 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1149654383 17:58302588-58302610 CTGTGTGTTTCTGACAGTGGTGG - Intronic
1149793824 17:59501113-59501135 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1149909360 17:60552836-60552858 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1150557923 17:66269935-66269957 TTGGGTGTTTCTCACAGAGGAGG - Intergenic
1150703997 17:67471166-67471188 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1152129301 17:78466402-78466424 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1152487102 17:80601598-80601620 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1152824092 17:82453231-82453253 CTGGGTGTTTCTCAGAGAGGGGG + Intergenic
1153605225 18:6826718-6826740 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1153634257 18:7099431-7099453 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1154358538 18:13641137-13641159 CTGTGAATTTCCCAGAGAGGAGG + Intronic
1154989982 18:21591700-21591722 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1155595120 18:27476826-27476848 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1156326096 18:36076926-36076948 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1157600088 18:48888370-48888392 CTGTGAGGCTGGCACAGAGGGGG + Intergenic
1157629076 18:49079435-49079457 TTGGGAGTTTCTCGCAGAGGGGG + Intronic
1157640123 18:49203816-49203838 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1157677075 18:49577048-49577070 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1157799593 18:50608753-50608775 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1158148956 18:54344537-54344559 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1159157921 18:64608358-64608380 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1159340304 18:67126217-67126239 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1160011782 18:75111500-75111522 CTGTGAGTCTCTCTTAGTAGAGG - Intergenic
1160544054 18:79641147-79641169 GTGTGAGTCTCACTCACAGGAGG - Intergenic
1160916363 19:1498644-1498666 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1162255335 19:9484255-9484277 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1162542137 19:11303520-11303542 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1162714629 19:12622316-12622338 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1162887208 19:13704490-13704512 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1163905485 19:20148804-20148826 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1163996005 19:21048215-21048237 CTGGGTGTTTCTCGCAGAGGGGG + Intronic
1164011999 19:21211991-21212013 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1164043046 19:21510611-21510633 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1164105488 19:22106160-22106182 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1164167962 19:22699827-22699849 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1164193007 19:22928550-22928572 TTGGGTGTATCTCACAGAGGGGG - Intergenic
1164218791 19:23173981-23174003 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1164244880 19:23420200-23420222 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1164256480 19:23532868-23532890 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1164466633 19:28492573-28492595 CTGTGAGGCTTTCACAGGGCTGG - Intergenic
1164652092 19:29898370-29898392 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1165192675 19:34078519-34078541 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1165282811 19:34812728-34812750 ATGTAAGTATCTCAAAGAGGTGG + Intergenic
1165727475 19:38123296-38123318 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1165883277 19:39058566-39058588 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1166028053 19:40107247-40107269 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1166030216 19:40119329-40119351 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1166180508 19:41104201-41104223 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1166261897 19:41645821-41645843 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1166262258 19:41648567-41648589 CTGGGTGTCTGTCACAGAGATGG + Intronic
1166363164 19:42264309-42264331 TTGTGAGTCTCTCATATAGATGG + Intergenic
1166532081 19:43548736-43548758 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1166708293 19:44921143-44921165 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1166888575 19:45975722-45975744 CTGTGTGTGTCACACAGAGGGGG - Intergenic
1167897336 19:52592810-52592832 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1167907902 19:52677090-52677112 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1168226427 19:54998664-54998686 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1168409921 19:56133399-56133421 CTGAGTCTCTCTCACAGATGAGG - Intronic
925042319 2:741129-741151 CTGTAAGTCTATCAAACAGGCGG + Intergenic
925155442 2:1645867-1645889 CTGTGAGTCCCTCCCAGCGGTGG - Intronic
925686228 2:6476545-6476567 CTGTCAGTCCCACCCAGAGGAGG + Intergenic
926215190 2:10901980-10902002 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
926674625 2:15610915-15610937 TTGGGTGTTTCTCACAGAGGGGG + Intronic
927755744 2:25706414-25706436 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
927776743 2:25909756-25909778 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
927832938 2:26369889-26369911 TTGGGTGTTTCTCACAGAGGGGG + Intronic
927978876 2:27360203-27360225 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
928089134 2:28363505-28363527 CTGTGAGTCTTTCAAAGATGAGG - Intergenic
928597580 2:32870496-32870518 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
928834713 2:35529925-35529947 CTGTGAGCCTGTGACAGTGGTGG - Intergenic
929110899 2:38404344-38404366 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
929238104 2:39627554-39627576 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
929416630 2:41748660-41748682 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
929445277 2:41996143-41996165 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
929447573 2:42013761-42013783 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
929577619 2:43062548-43062570 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
929614886 2:43298561-43298583 TTGGGTGTTTCTCACAGAGGGGG - Intronic
929961724 2:46502282-46502304 CAGTGATTCTCTCACATAGAGGG + Intronic
930201380 2:48554757-48554779 TTGGGTGTTTCTCACAGAGGGGG + Intronic
930208634 2:48613886-48613908 TTGGGTGTTTCTCACAGAGGGGG + Intronic
930532107 2:52601769-52601791 GTTTTAGTCTCTCACAGAGATGG - Intergenic
930665217 2:54094917-54094939 TTGGGTGTTTCTCACAGAGGGGG + Intronic
930821658 2:55651738-55651760 TTGGGTGTTTCTCACAGAGGGGG - Intronic
930833689 2:55772965-55772987 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
931576593 2:63723248-63723270 TTGGGTGTTTCTCACAGAGGGGG - Intronic
931584422 2:63809875-63809897 TTGGGTGTTTCTCACAGAGGGGG - Intronic
931655842 2:64510979-64511001 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
931752224 2:65339669-65339691 TTGGGTGTTTCTCACAGAGGGGG - Intronic
931799734 2:65747224-65747246 CTGTGTGTCTCTCAGGGAGGGGG + Intergenic
931892906 2:66694692-66694714 CTGTGAACCTGTCATAGAGGGGG - Intergenic
932777275 2:74535805-74535827 GTGGGAGTCTCTAACAGATGTGG + Intronic
932807208 2:74795129-74795151 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
933810841 2:86031836-86031858 CCCTGAGCCCCTCACAGAGGTGG + Intronic
934309970 2:91852944-91852966 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
934703946 2:96463066-96463088 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
935630316 2:105209492-105209514 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
935991889 2:108726664-108726686 TTGGGTGTTTCTCACAGAGGGGG + Intronic
936528841 2:113261005-113261027 CTGTGTGTCCCTCAGAAAGGCGG - Intronic
936546700 2:113395968-113395990 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
937255967 2:120555774-120555796 CTGTGAGTCTCCGACGCAGGTGG + Intergenic
937437826 2:121893736-121893758 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
937890706 2:126936419-126936441 CTCTGAGTCCCTCACAGTGTTGG - Intergenic
937910591 2:127073741-127073763 CTGTTTGTCTGTCACTGAGGTGG - Intronic
937919253 2:127118931-127118953 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
938005449 2:127786888-127786910 TTGGGTGTTTCTCACAGAGGGGG + Intronic
939578280 2:143921338-143921360 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
939584931 2:143992498-143992520 TTGGGTGTTTCTCACAGAGGGGG - Intronic
940087577 2:149878116-149878138 CTGAGAGTAGGTCACAGAGGTGG + Intergenic
940196732 2:151103447-151103469 AAGAGAGGCTCTCACAGAGGAGG + Intergenic
940635729 2:156294276-156294298 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
941814301 2:169785057-169785079 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
942096482 2:172539025-172539047 CTGGGTGTTTCTCGCAGAGGGGG - Intergenic
942620894 2:177844569-177844591 TTGGGTGTTTCTCACAGAGGGGG + Intronic
942630930 2:177947730-177947752 TTGGGTGTTTCTCACAGAGGGGG - Intronic
942699889 2:178693937-178693959 CTTTGCTTCTCACACAGAGGAGG - Exonic
942753960 2:179318985-179319007 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
943296971 2:186153361-186153383 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
943323777 2:186474159-186474181 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
944061071 2:195569139-195569161 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
944262802 2:197695462-197695484 TTGGGTGTTTCTCACAGAGGGGG + Intronic
944283152 2:197922043-197922065 TTGGGTGTTTCTCACAGAGGGGG + Intronic
944593330 2:201238798-201238820 TTGGGTGTTTCTCACAGAGGAGG + Intronic
944625116 2:201562546-201562568 TTGGGTGTTTCTCACAGAGGGGG + Intronic
944732769 2:202534290-202534312 TTGGGTGTTTCTCACAGAGGGGG + Intronic
945090177 2:206171014-206171036 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
945114700 2:206400040-206400062 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
947235708 2:227938649-227938671 CAATGAGTCCCTGACAGAGGAGG - Intergenic
947901175 2:233723561-233723583 TTGGGTGTTTCTCACAGAGGGGG + Intronic
948651525 2:239448969-239448991 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1169167892 20:3440483-3440505 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1169371101 20:5028617-5028639 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1169718432 20:8645271-8645293 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1170424608 20:16226568-16226590 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1170811348 20:19677737-19677759 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1171035977 20:21713404-21713426 GTGTGTGTCTTGCACAGAGGTGG + Intronic
1171462139 20:25304145-25304167 CTGTGCGGCCCTCACTGAGGTGG + Intronic
1172051265 20:32121233-32121255 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1172141450 20:32724904-32724926 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1172338195 20:34133624-34133646 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1172348731 20:34224182-34224204 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1172349127 20:34228615-34228637 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1172466009 20:35155011-35155033 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1173472395 20:43333822-43333844 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1173566990 20:44047808-44047830 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1173603149 20:44310445-44310467 CTGTGAGTATCTCACAGGCGGGG + Intronic
1173769339 20:45645051-45645073 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1174129331 20:48330565-48330587 CAATGTGTCTATCACAGAGGAGG - Intergenic
1174336475 20:49865103-49865125 CTGTGAGGCTCCCTCAGAGGAGG + Intronic
1175136109 20:56825428-56825450 ATGTGTGTCTCTAGCAGAGGAGG - Intergenic
1175361049 20:58413179-58413201 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1177134014 21:17291541-17291563 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1177177804 21:17718675-17718697 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1178494594 21:33076053-33076075 CAGAGGATCTCTCACAGAGGTGG - Intergenic
1178796618 21:35750939-35750961 CTTTGGGTCTCTGACAGAGGAGG - Intronic
1180123208 21:45767832-45767854 CTGACAGGCTCTCAGAGAGGAGG + Intronic
1180672235 22:17561994-17562016 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1181273835 22:21676393-21676415 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1181538485 22:23560508-23560530 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1181599033 22:23937857-23937879 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1181981782 22:26772179-26772201 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1182343425 22:29643321-29643343 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1182359061 22:29736004-29736026 CTGTGACTCGCTCCCAGCGGAGG + Intronic
1182600016 22:31454954-31454976 CTGTGAGATTCTCAAAGAGGTGG + Intronic
1182616018 22:31590998-31591020 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1183595668 22:38808499-38808521 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1183840892 22:40500424-40500446 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1183845770 22:40538531-40538553 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1183995525 22:41630530-41630552 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1184169347 22:42749982-42750004 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1184173583 22:42773239-42773261 CTGGGATTCCCTCCCAGAGGAGG - Intergenic
1184199915 22:42961413-42961435 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1185388891 22:50548519-50548541 CTGTGAGCGCCTCGCAGAGGAGG - Exonic
949853720 3:8441186-8441208 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
950049233 3:9973764-9973786 GTGTGACTCTTTCTCAGAGGAGG + Intronic
950253480 3:11486865-11486887 TTGGGTGTTTCTCACAGAGGGGG + Intronic
950819713 3:15743319-15743341 TTGGGTGTTTCTCACAGAGGGGG - Intronic
951013111 3:17703952-17703974 TTGGGTGTTTCTCACAGAGGGGG + Intronic
951351585 3:21613520-21613542 CTGTCAGTAACCCACAGAGGAGG - Intronic
952896220 3:38080846-38080868 TTGGGTGTTTCTCACAGAGGGGG + Intronic
953084110 3:39650917-39650939 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
953257909 3:41307110-41307132 TTGGGTGTTTCTCACAGAGGGGG - Intronic
953426512 3:42799251-42799273 TTGGGTGTTTCTCACAGAGGGGG - Intronic
953652486 3:44820381-44820403 TTGGGTGTTTCTCACAGAGGGGG + Intronic
953692143 3:45128461-45128483 TTGTGTCTCTCTCACTGAGGGGG - Intronic
953855372 3:46495645-46495667 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
953959659 3:47257106-47257128 TTGGGTGTTTCTCACAGAGGGGG - Intronic
954059842 3:48057573-48057595 TTGGGTGTTTCTCACAGAGGGGG - Intronic
954081245 3:48213043-48213065 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
954083412 3:48225574-48225596 GTGTGAGTGTGACACAGAGGTGG + Intergenic
954523729 3:51250236-51250258 TTGGGTGTTTCTCACAGAGGGGG - Intronic
955297760 3:57748722-57748744 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
955362694 3:58289265-58289287 TTGGGTGTTTCTCACAGAGGGGG + Intronic
955394538 3:58549101-58549123 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
955434638 3:58889583-58889605 TTGGGTGTTTCTCACAGAGGGGG + Intronic
955468239 3:59258576-59258598 CAAAGACTCTCTCACAGAGGTGG + Intergenic
955674218 3:61433816-61433838 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
956270919 3:67445582-67445604 TTGGGTGTTTCTCACAGAGGGGG - Intronic
956697324 3:71929509-71929531 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
957203525 3:77165525-77165547 TTGGGTGTTTCTCACAGAGGGGG - Intronic
957316509 3:78582512-78582534 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
958560646 3:95744193-95744215 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
958957115 3:100476959-100476981 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
959042993 3:101440535-101440557 TTGGGTGTTTCTCACAGAGGGGG - Intronic
959221808 3:103530942-103530964 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
959418940 3:106110563-106110585 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
959585957 3:108025696-108025718 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
960698117 3:120414954-120414976 TTGGGTGTTTCTCACAGAGGGGG - Intronic
960817700 3:121689614-121689636 TTGGGTGTTTCTCACAGAGGGGG - Intronic
960823305 3:121757346-121757368 GTGTGTGTCTCTCACATAGCTGG + Intergenic
960862443 3:122165867-122165889 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
960921243 3:122748345-122748367 TTGGGTGTTTCTCACAGAGGGGG - Intronic
961120012 3:124366235-124366257 TTGGGTGTTTCTCACAGAGGGGG + Intronic
961484294 3:127206655-127206677 ATGTGAGCATCTCACAGGGGAGG - Intergenic
961729817 3:128956138-128956160 TTGGGTGTTTCTCACAGAGGGGG - Intronic
962063409 3:131953205-131953227 TTGGGTGTTTCTCACAGAGGGGG - Intronic
962112597 3:132470017-132470039 TTGGGTGTTTCTCACAGAGGGGG + Intronic
962245376 3:133786176-133786198 TTGGGTGTTTCTCACAGAGGGGG - Intronic
962283139 3:134066933-134066955 CTGAGAGTTTCTGACTGAGGCGG + Intronic
962572495 3:136724567-136724589 TTGGGTGTTTCTCACAGAGGGGG - Intronic
963770466 3:149381361-149381383 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
964094505 3:152915930-152915952 CTGTGAGTCACTCACCTTGGAGG - Intergenic
964766136 3:160179536-160179558 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
966360327 3:179122044-179122066 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
966375250 3:179290328-179290350 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
966748706 3:183302150-183302172 CTGTGAGACTCCCACAGGAGAGG + Intronic
967326593 3:188246636-188246658 CTGTGAGTCCCCCACAGGGCAGG + Intronic
967473058 3:189885342-189885364 CTATGAGTGTCTCAAAGATGGGG + Intronic
967897820 3:194413758-194413780 CTTTGTGTCTATCACAGTGGAGG - Exonic
968175056 3:196542613-196542635 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
968201662 3:196761187-196761209 TTGGGTGTTTCTCACAGAGGGGG + Intronic
968338883 3:197937822-197937844 CAGTGAGCCTCTCACATAGCTGG - Intronic
968666869 4:1827319-1827341 TTGGGTGTTTCTCACAGAGGGGG + Intronic
969358192 4:6643691-6643713 GTGTGAGTTCCACACAGAGGAGG + Intergenic
969374929 4:6756622-6756644 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
969507942 4:7599642-7599664 CTGTGATTCTGGCACAGCGGGGG + Intronic
970472455 4:16392561-16392583 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
971423611 4:26495435-26495457 CTGTGTGTGTCTCAGAGAGAGGG - Intergenic
972368848 4:38401766-38401788 CTGTGAGTCTCTCTCATCTGAGG + Intergenic
972551627 4:40140620-40140642 TTGGGTGTTTCTCACAGAGGGGG + Intronic
973281112 4:48362792-48362814 TTGGGTGTTTCTCACAGAGGGGG + Intronic
973593984 4:52466550-52466572 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
973672586 4:53236870-53236892 TTGGGTGTTTCTCACAGAGGGGG + Intronic
973784817 4:54324824-54324846 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
973846617 4:54919439-54919461 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
973866415 4:55118694-55118716 TTGTGAGTGTCTTACAGAAGAGG + Exonic
974588748 4:63917976-63917998 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
975477734 4:74842723-74842745 CTATGAATCTCTCAGAGAGTGGG + Intergenic
975605225 4:76148232-76148254 CGGAGAGTCTCGGACAGAGGGGG + Intronic
976340601 4:83942859-83942881 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
976607537 4:86996688-86996710 TTGGGTGTTTCTCACAGAGGGGG - Intronic
977027328 4:91835166-91835188 CTGTGAGCCTTTCACTGGGGAGG + Intergenic
978273866 4:106925130-106925152 CTGTGAGTCTCTTGCACAGGAGG - Intronic
978518739 4:109596763-109596785 TTGGGTGTTTCTCACAGAGGGGG + Intronic
978519890 4:109604344-109604366 TTGGGTGTTTCTCACAGAGGGGG - Intronic
979248415 4:118535915-118535937 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
979622712 4:122813157-122813179 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
979641297 4:123015215-123015237 TTGGGTGTTTCTCACAGAGGGGG + Intronic
980895425 4:138855229-138855251 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
980972507 4:139580377-139580399 TTCTGTGACTCTCACAGAGGAGG + Intronic
981219396 4:142213873-142213895 CTGTGACTCACTCACGGAGGAGG - Intronic
981959182 4:150514563-150514585 CTGTGTGTCTCTAATAGAGCTGG + Intronic
981970934 4:150661032-150661054 TTGGGTGTTTCTCACAGAGGGGG - Intronic
982025936 4:151254352-151254374 TTGGGTGTTTCTCACAGAGGGGG + Intronic
982615509 4:157635855-157635877 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
982709465 4:158745815-158745837 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
982723644 4:158882960-158882982 TTGGGTGTTTCTCACAGAGGGGG - Intronic
982820443 4:159938391-159938413 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
983190190 4:164746796-164746818 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
984004603 4:174294074-174294096 TTGGGTGTTTCTCACAGAGGGGG + Intronic
984533292 4:180944257-180944279 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
985255781 4:188068687-188068709 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
985509328 5:303313-303335 CTGTGTGTCTAACACAGACGGGG + Intronic
985600575 5:827770-827792 TTGGGTGTTTCTCACAGAGGGGG + Intronic
985892116 5:2724216-2724238 CTGTGTGTCTCTCTCGGAGCAGG - Intergenic
987267772 5:16276210-16276232 TTGGGTGTTTCTCACAGAGGAGG + Intergenic
987469547 5:18310689-18310711 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
987583390 5:19824209-19824231 GTGTGCTCCTCTCACAGAGGGGG + Intronic
988552512 5:32209599-32209621 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
988760016 5:34305045-34305067 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
989211157 5:38861151-38861173 TTGGGTGTTTCTCACAGAGGGGG + Intronic
989633655 5:43511992-43512014 TTGGGTGTTTCTCACAGAGGGGG - Intronic
990426522 5:55695298-55695320 TTGGGTGTTTCTCACAGAGGGGG + Intronic
991073460 5:62512635-62512657 TTGGGTGTTTCTCACAGAGGGGG + Intronic
991127249 5:63083246-63083268 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
991373515 5:65941280-65941302 TTGGGTGTTTCTCACAGAGGAGG - Intronic
991407884 5:66319671-66319693 CTGTGACTGTCTGACCGAGGAGG - Intergenic
991450216 5:66743467-66743489 CTGCGTGCCTCCCACAGAGGTGG + Intronic
991723316 5:69514555-69514577 TTGGGTGTTTCTCACAGAGGGGG + Intronic
992259332 5:74954126-74954148 CTGTGAGTCTGTGACAGAAAAGG + Intergenic
992290232 5:75272121-75272143 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
992340647 5:75819674-75819696 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
992374325 5:76173010-76173032 TTGGGTGTTTCTCACAGAGGGGG - Intronic
992391513 5:76335452-76335474 TTGGGTGTTTCTCACAGAGGGGG + Intronic
992443359 5:76813632-76813654 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
992469396 5:77041843-77041865 TTGGGTGTTTCTCACAGAGGGGG + Intronic
992544097 5:77794341-77794363 TTGGGTGTTTCTCACAGAGGGGG + Intronic
992574958 5:78098244-78098266 TTGGGTGTTTCTCACAGAGGGGG - Intronic
992600035 5:78390683-78390705 TTGGGTGTTTCTCACAGAGGGGG + Intronic
993162564 5:84311590-84311612 TTGGGTGTTTCTCACAGAGGGGG + Intronic
993657390 5:90594515-90594537 TTGGGTGTTTCTCACAGAGGGGG + Intronic
995123363 5:108558406-108558428 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
995516151 5:112955756-112955778 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
995894936 5:117001795-117001817 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
995942077 5:117599008-117599030 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
995994661 5:118283503-118283525 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
996159962 5:120148689-120148711 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
996982034 5:129509603-129509625 CTATGATGCTTTCACAGAGGTGG - Intronic
997336122 5:133109738-133109760 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
998021579 5:138776075-138776097 TTGGGTGTTTCTCACAGAGGGGG + Intronic
998104781 5:139461624-139461646 CTGTGACTCTGTCATGGAGGGGG + Intronic
998431506 5:142074695-142074717 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
999251632 5:150185805-150185827 CTGTGACTCTATCAGAGAAGTGG - Intergenic
999580950 5:153037247-153037269 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
999693982 5:154172069-154172091 CTGTGTGCCTGGCACAGAGGTGG + Intronic
999734024 5:154499169-154499191 CTGTGGGTTTCTCACAGCTGGGG - Intergenic
1000159585 5:158583945-158583967 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1000985966 5:167861006-167861028 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1001098422 5:168794408-168794430 CTGTGAGTCACTCAGAGCTGGGG - Intronic
1001366729 5:171148352-171148374 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1001393835 5:171403037-171403059 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1001931173 5:175674134-175674156 GTGTGAGTCTCTCACTGATAAGG + Intronic
1002014301 5:176306875-176306897 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1002031764 5:176434776-176434798 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1002116341 5:176963111-176963133 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1002205363 5:177559497-177559519 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1002341235 5:178517927-178517949 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1004388621 6:15190534-15190556 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1004414673 6:15414845-15414867 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1004448576 6:15725588-15725610 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1004663978 6:17734700-17734722 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1005606540 6:27484132-27484154 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1005644153 6:27825858-27825880 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1005865593 6:29933704-29933726 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1006040118 6:31245266-31245288 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1006128128 6:31853314-31853336 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1006141214 6:31931294-31931316 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1006231745 6:32594228-32594250 TTGGGTGTTTCTCACAGAGGAGG + Intergenic
1006351797 6:33526112-33526134 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1006492805 6:34399090-34399112 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1006624166 6:35385596-35385618 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1007063285 6:38963727-38963749 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1007645816 6:43380045-43380067 CTGTGAGTTTCTCAAAGATAAGG - Intergenic
1007673969 6:43579940-43579962 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1008111941 6:47505061-47505083 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1008553419 6:52655020-52655042 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1008841388 6:55909347-55909369 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1009629008 6:66170365-66170387 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1010239570 6:73602402-73602424 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1010245684 6:73659873-73659895 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1010264255 6:73850459-73850481 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1010513434 6:76745461-76745483 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1010616837 6:78023223-78023245 CAGGGAGTATTTCACAGAGGAGG + Intergenic
1011148344 6:84243811-84243833 CTGGGTGTTTCTCGCAGAGGGGG + Intergenic
1011291514 6:85781746-85781768 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1011404892 6:87009092-87009114 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1011588587 6:88949075-88949097 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1011765192 6:90611962-90611984 CTGTGAGGCTGTGACAGAGAGGG - Intergenic
1012428838 6:99142830-99142852 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1013207035 6:107954430-107954452 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1013326353 6:109048058-109048080 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1013638168 6:112048319-112048341 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1013679456 6:112508368-112508390 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1013681141 6:112527692-112527714 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1014556554 6:122847817-122847839 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1015070470 6:129087926-129087948 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1015477096 6:133666147-133666169 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1016931973 6:149420548-149420570 GGGTGAGACTCTGACAGAGGGGG + Intergenic
1017465359 6:154688216-154688238 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1017493612 6:154965630-154965652 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1017660860 6:156671129-156671151 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1017830960 6:158127960-158127982 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1017843116 6:158238458-158238480 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1017851212 6:158308032-158308054 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1018295619 6:162340101-162340123 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1018713504 6:166514408-166514430 CTGGGAGGTTTTCACAGAGGAGG + Intronic
1019286963 7:228499-228521 GTGTCAGCCTCTCACAGGGGAGG - Exonic
1019439851 7:1040136-1040158 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1019864524 7:3694371-3694393 CTGTGAGTGTCTATGAGAGGAGG - Intronic
1019981526 7:4624864-4624886 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1020498984 7:8891249-8891271 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1020616129 7:10464754-10464776 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1021647585 7:22801811-22801833 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1021672082 7:23045325-23045347 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1021785050 7:24143122-24143144 CTGTGAATCTTCCACAGAAGTGG - Intergenic
1021838202 7:24701449-24701471 GTGTGAGTTTGTCACAGAAGGGG + Intronic
1021872864 7:25020179-25020201 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1022393133 7:29961100-29961122 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1024310022 7:47960333-47960355 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1024539098 7:50461013-50461035 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1024626019 7:51209012-51209034 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1024988798 7:55219107-55219129 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1025803352 7:64808623-64808645 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1026015156 7:66666502-66666524 CTGGGAGCCTGGCACAGAGGGGG - Intronic
1026042097 7:66876799-66876821 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1026868611 7:73837246-73837268 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1027087641 7:75275693-75275715 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1027371501 7:77510542-77510564 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1027373620 7:77532935-77532957 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1027961431 7:84950816-84950838 CTGTGTGTCTCTCATAAGGGTGG + Intergenic
1028650687 7:93147476-93147498 CTGAGGGTCTCTCAAAGATGGGG - Intronic
1028786620 7:94801663-94801685 ATGAGCTTCTCTCACAGAGGAGG + Intergenic
1029402650 7:100355497-100355519 CTGTGGCTCTCTCTCAGAGGGGG - Intronic
1029405373 7:100371726-100371748 CTGTGGCTCTCTCACAGACAGGG - Intronic
1029468358 7:100740331-100740353 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1030288465 7:107849008-107849030 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1030368523 7:108672353-108672375 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1030497335 7:110316083-110316105 TTGTGTGTCGCTCACAGAGAAGG - Intergenic
1032042613 7:128576041-128576063 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1032056855 7:128690368-128690390 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1032504736 7:132426387-132426409 CTGTGTGCCTCAGACAGAGGTGG - Intronic
1033114388 7:138612359-138612381 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1033173221 7:139101971-139101993 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1033236221 7:139639846-139639868 CTGTCTGCCTCTCACATAGGAGG - Intronic
1033294270 7:140115757-140115779 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1033625569 7:143106982-143107004 CTGGGTTTCTCTCACAGTGGAGG - Intergenic
1034322761 7:150199569-150199591 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1035330906 7:158096880-158096902 CTGGGAGTTTCTCACTGCGGGGG + Intronic
1035412730 7:158658116-158658138 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1035507596 8:148877-148899 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1035611908 8:972650-972672 TTGTGTGTTTCTCGCAGAGGGGG + Intergenic
1035630167 8:1101445-1101467 CTGTGAGTCGCTCACATTGTGGG - Intergenic
1036482845 8:9153435-9153457 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1036506810 8:9364405-9364427 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1036536390 8:9656651-9656673 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1039072033 8:33657566-33657588 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1039081543 8:33738760-33738782 ATGTGAGTCTGGCACAGAGTGGG + Intergenic
1039516017 8:38134285-38134307 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1040093055 8:43418653-43418675 TTGGGTGTCTCTCCCAGAGGGGG + Intergenic
1040121077 8:43686904-43686926 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1041071071 8:54126404-54126426 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1041358370 8:57023125-57023147 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1041734488 8:61095370-61095392 CTGGCAGTCTCTCAAAGAAGTGG + Intronic
1041796208 8:61751903-61751925 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1042049410 8:64687092-64687114 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1042303950 8:67312200-67312222 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1042475966 8:69246823-69246845 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1042669114 8:71241448-71241470 CTGAAAGCCCCTCACAGAGGGGG + Intronic
1044661136 8:94592319-94592341 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1045009452 8:97944776-97944798 CTGTGAGTTTCTCTCAGTGTTGG - Intronic
1047267188 8:123316547-123316569 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1047388440 8:124431343-124431365 CTGGGTGTTTCTCGCAGAGGGGG + Intergenic
1047687738 8:127317844-127317866 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1047847572 8:128825012-128825034 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1048061349 8:130922240-130922262 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1048344578 8:133567127-133567149 CTGTGGGTCTCTCAAGGTGGAGG + Intronic
1048834237 8:138503082-138503104 CAGTGATTCTCTTCCAGAGGGGG + Intergenic
1050558444 9:6808657-6808679 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1051258277 9:15234993-15235015 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1051277171 9:15407689-15407711 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1051553336 9:18355113-18355135 CTGGGAGACCCTCACTGAGGAGG + Intergenic
1051661687 9:19433185-19433207 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1052942239 9:34138703-34138725 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1053255592 9:36614468-36614490 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1053457710 9:38243553-38243575 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1053468349 9:38325927-38325949 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1053489831 9:38490068-38490090 TAGTGAGTATCTCACAGATGTGG + Intergenic
1053634428 9:39983043-39983065 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1054209459 9:62267654-62267676 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1054788611 9:69234086-69234108 CTGTGAGTCTCTCACAGAGGTGG - Intronic
1055133697 9:72805575-72805597 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1055136843 9:72839622-72839644 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1055305025 9:74920678-74920700 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1055413968 9:76063360-76063382 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1055948809 9:81711873-81711895 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1056671033 9:88626990-88627012 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1056703867 9:88934907-88934929 CTGTGAGGCTCTTTCATAGGAGG - Intergenic
1057535956 9:95906608-95906630 CTGAGAGTATCTGAAAGAGGGGG + Intronic
1057629238 9:96706868-96706890 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1057751778 9:97797607-97797629 TTGCGTGTTTCTCACAGAGGGGG - Intergenic
1058437160 9:104973508-104973530 CTGAGAGTCTGTCACAGCGTGGG + Intergenic
1058659386 9:107256085-107256107 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1058723283 9:107778242-107778264 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1059121446 9:111642573-111642595 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1059211563 9:112515848-112515870 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1059246416 9:112853308-112853330 CTGTGTGTCTGTCACAAGGGAGG + Intronic
1059967923 9:119634263-119634285 CTGGTAGTTTCTCTCAGAGGAGG + Intergenic
1060041663 9:120305752-120305774 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1060065555 9:120497374-120497396 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1060350387 9:122853345-122853367 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1060352227 9:122868705-122868727 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1060651112 9:125328231-125328253 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1060687605 9:125625203-125625225 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1060714274 9:125908120-125908142 CTTTGTGTTTCTCACATAGGTGG - Intronic
1060724493 9:125997973-125997995 CTGTGACTATTTTACAGAGGAGG - Intergenic
1061982506 9:134114813-134114835 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1062593965 9:137289111-137289133 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1185585118 X:1236988-1237010 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1185622960 X:1464685-1464707 CTGTGAGTCCCTGATAGAGAAGG - Exonic
1186922858 X:14302124-14302146 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1187976217 X:24708416-24708438 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1188477613 X:30603844-30603866 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1189569848 X:42285064-42285086 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1189587096 X:42473441-42473463 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1189956122 X:46276606-46276628 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1190521324 X:51280933-51280955 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1190680725 X:52826217-52826239 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1190769826 X:53505031-53505053 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1191617807 X:63188642-63188664 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1192621746 X:72682888-72682910 TTGGGTGTTTCTCACAGAGGGGG - Intronic
1192969510 X:76217184-76217206 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1193345059 X:80396304-80396326 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1193372513 X:80713654-80713676 TTGGGTGTCTCTCGCAGAGGGGG - Intronic
1193782691 X:85723268-85723290 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1193924530 X:87466829-87466851 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1194567960 X:95517236-95517258 CTGTGATTCTCACATGGAGGAGG + Intergenic
1194611359 X:96050319-96050341 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1195035865 X:100971760-100971782 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1196404099 X:115346529-115346551 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1197736374 X:129851934-129851956 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1198476055 X:136999382-136999404 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1199452461 X:147991689-147991711 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1199586645 X:149421733-149421755 TTGGGTGTTTCTCACAGAGGGGG - Intergenic
1199818335 X:151420348-151420370 GTGTGATTCTCTGACAGAGAAGG + Intergenic
1200280464 X:154773332-154773354 TTGGGTGTTTCTCACAGAGGGGG + Intronic
1200952770 Y:8917517-8917539 TTGGGTGTTTCTCACAGAGGGGG + Intergenic
1201943416 Y:19483773-19483795 CTCTGCTTCTCTAACAGAGGAGG + Intergenic
1202070651 Y:20988513-20988535 ATGTGAATCTCTCACAGGGGTGG - Intergenic
1202186956 Y:22195853-22195875 CTTTGCGGCTCTCACAGTGGTGG + Intergenic
1202204404 Y:22390543-22390565 CTTTGCGGCTCTCACAGTGGTGG - Intronic