ID: 1054792624

View in Genome Browser
Species Human (GRCh38)
Location 9:69270033-69270055
Sequence TGCCAAAGACATGGTGAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054792624_1054792627 -4 Left 1054792624 9:69270033-69270055 CCGTGCTCACCATGTCTTTGGCA No data
Right 1054792627 9:69270052-69270074 GGCAATCAGGTATAGCCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054792624 Original CRISPR TGCCAAAGACATGGTGAGCA CGG (reversed) Intergenic
No off target data available for this crispr