ID: 1054797744

View in Genome Browser
Species Human (GRCh38)
Location 9:69318209-69318231
Sequence GGAAATGTGTGTATAGGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054797737_1054797744 3 Left 1054797737 9:69318183-69318205 CCTAGGGGTGAGTAAGAGTGCCC No data
Right 1054797744 9:69318209-69318231 GGAAATGTGTGTATAGGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054797744 Original CRISPR GGAAATGTGTGTATAGGTAT TGG Intergenic
No off target data available for this crispr