ID: 1054799371

View in Genome Browser
Species Human (GRCh38)
Location 9:69331934-69331956
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054799366_1054799371 7 Left 1054799366 9:69331904-69331926 CCTTCTTGGCTCATTTCTGATGG 0: 1
1: 0
2: 3
3: 12
4: 208
Right 1054799371 9:69331934-69331956 GCTACTGCTGCCACCAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr