ID: 1054799728

View in Genome Browser
Species Human (GRCh38)
Location 9:69335365-69335387
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054799720_1054799728 16 Left 1054799720 9:69335326-69335348 CCATGAGTGTGGAGCGGTGGAAT 0: 1
1: 1
2: 0
3: 6
4: 102
Right 1054799728 9:69335365-69335387 GGGCAGGTGACTGCTAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr