ID: 1054803897

View in Genome Browser
Species Human (GRCh38)
Location 9:69379833-69379855
Sequence GCTCAGAGCACACTGCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 225}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054803897 Original CRISPR GCTCAGAGCACACTGCTGGA TGG (reversed) Intronic
900000487 1:12343-12365 GCTCAGACCAGCCGGCTGGAGGG + Intergenic
900020200 1:182862-182884 GCTCAGACCAGCCGGCTGGAGGG + Intergenic
900787519 1:4658027-4658049 GCTCAGAGCTCACCCGTGGAGGG + Intronic
901218292 1:7567031-7567053 GCTCAGAGCAGACAGCTGTTAGG + Intronic
901754275 1:11431680-11431702 GCAAAAAGCACACCGCTGGATGG + Intergenic
902079654 1:13812354-13812376 GATCACAGCACACTGCTCGATGG + Intronic
902745057 1:18468375-18468397 GCTCTGGGCACTATGCTGGAAGG - Intergenic
903031836 1:20469222-20469244 CCTCAGAGGAGGCTGCTGGAGGG - Intergenic
903163251 1:21504008-21504030 GCTCAGAGCTGACTGCTAGGAGG + Intergenic
903659763 1:24969879-24969901 CCTCAGAGCCCACCCCTGGAGGG - Intergenic
904327071 1:29733606-29733628 GCACAGAGCACACTGTTTCATGG - Intergenic
904920716 1:34005877-34005899 TCACAGAGCATATTGCTGGATGG - Intronic
905276344 1:36821019-36821041 GCTGAGAGGACACATCTGGAAGG + Intronic
905674457 1:39816038-39816060 GCTCAGAGCACACTACTGCCAGG + Intergenic
905767355 1:40612462-40612484 GCTGGTAGGACACTGCTGGAGGG + Intergenic
905917594 1:41696392-41696414 TCTAAGAGCACAGTGCTGGCGGG + Intronic
907443156 1:54490602-54490624 GCGCAGAGCTGACTGCGGGAGGG + Intergenic
909496348 1:76283102-76283124 GCTCAGAGGTCACTGAGGGATGG - Intronic
909634466 1:77800694-77800716 ACTCTTAGCACACTGCTTGAGGG + Intronic
912656086 1:111487425-111487447 GTCCAGAGCACAATGCTGGTAGG - Intronic
912762842 1:112384431-112384453 GCCCAGATCACACAGCTGGTAGG + Intergenic
917294240 1:173502444-173502466 GGCCAGAGCAGACTGCTGGGTGG - Intronic
917802110 1:178580701-178580723 GCTCAGATCCCACTTCTGGGAGG + Intergenic
918042097 1:180919644-180919666 GCTCAGTGGCCACTGCTGAAAGG + Intronic
920271048 1:204763997-204764019 GCTCTGCGCCCACCGCTGGAGGG - Intergenic
920436513 1:205950330-205950352 GGCCAGAGCACAGTCCTGGAGGG - Intergenic
922005640 1:221528083-221528105 GCTCAGGGCACACTTCTTCAGGG - Intergenic
922015496 1:221641783-221641805 GCCTAAATCACACTGCTGGAGGG + Intergenic
923535044 1:234842925-234842947 GTTCACAGCACACATCTGGAGGG + Intergenic
924934463 1:248756356-248756378 GTGCAGAGCACACTGCAGGCAGG - Intergenic
1062942640 10:1435565-1435587 GATGAGAGGACACTGCAGGATGG - Intronic
1063090621 10:2863459-2863481 TCTCAGAGCACAGGGCTGGGTGG - Intergenic
1064744945 10:18469172-18469194 ACTCATAGCTCACTGCAGGATGG - Intronic
1070968202 10:80542927-80542949 GCTCAGAGCACTCTGCTGGCTGG - Intronic
1073467788 10:103704399-103704421 GCTGAGACCACACTGGTGGCTGG + Intronic
1075028483 10:119004379-119004401 GCTCTTAGCACACTGCTAGGTGG + Intergenic
1075716298 10:124557761-124557783 GTACAGAGCACACTGGGGGAGGG + Intronic
1076013892 10:127012578-127012600 GCTGAGAGCCCACTCCTGGATGG + Intronic
1076213761 10:128675540-128675562 GCTCACTGCACACTGCAGGCAGG - Intergenic
1076442233 10:130487919-130487941 CCTCAGAACACAGTTCTGGAAGG - Intergenic
1077522218 11:3043165-3043187 GCTCTGAGCACACTGCTTCCAGG + Intronic
1078446361 11:11407934-11407956 GCTCAGGACACACTGCTTCAAGG - Intronic
1079396788 11:20070585-20070607 TCTTACCGCACACTGCTGGAAGG + Intronic
1081621557 11:44621949-44621971 GCCCAGAGCTCACAGCTGGAAGG + Intergenic
1083192978 11:61065916-61065938 CCTCAGTGCACGCAGCTGGAAGG + Intergenic
1083848755 11:65352974-65352996 ACACAGAGCCCTCTGCTGGATGG + Exonic
1084691621 11:70730550-70730572 GCTCTGAGGACAGTGCTGGAAGG - Intronic
1087474257 11:98617672-98617694 ACTCAGGGCACACTGATGCAAGG + Intergenic
1089659101 11:119974369-119974391 GCTCAGAGAAGACAGCAGGAGGG - Intergenic
1090217570 11:124983680-124983702 GGTCACAACACACTGATGGATGG + Intronic
1091373577 12:12474-12496 GCTCAGACCAGCCAGCTGGAGGG + Intergenic
1091408181 12:221719-221741 TGACAGAGTACACTGCTGGAGGG - Intronic
1091775658 12:3183120-3183142 GCTCAGAGAAGGCTTCTGGAGGG + Intronic
1092112365 12:5972682-5972704 GCTCACTGCACACTGCTGGGAGG - Intronic
1092526244 12:9311948-9311970 GCTCAGACCAGCCAGCTGGAGGG + Intergenic
1092541032 12:9419842-9419864 GCTCAGACCAGCCAGCTGGAGGG - Intergenic
1093788208 12:23216443-23216465 ACCCAGGGCACACTGCTGCAAGG - Intergenic
1094512013 12:31102644-31102666 GCTCAGACCAGCCAGCTGGAGGG + Intronic
1101610397 12:106286144-106286166 GCTCAGAACTAACTGCGGGATGG + Intronic
1101877378 12:108604716-108604738 GCTCAGATCACAGTGTGGGAGGG - Intergenic
1102441909 12:112969890-112969912 GCTGAGACCACACAGCCGGATGG - Intronic
1102992526 12:117325245-117325267 GCTTAGAGCACACGGCTGCCTGG - Intronic
1104016805 12:124967086-124967108 GCTCAGGGCAGAGTGCTGGTCGG + Intronic
1106587577 13:31070588-31070610 GCTCAGAGCAGACTTCTAGCAGG - Intergenic
1107112457 13:36712496-36712518 GCTCAGAGTACCATGCGGGAGGG - Intergenic
1107310078 13:39067569-39067591 GCTGACAGAACACTGCTGAAGGG - Intergenic
1107608448 13:42086807-42086829 TTTCAGACCACAGTGCTGGAGGG + Intronic
1109954258 13:69545013-69545035 GCTCAGAGCTCACTGCAGCCTGG - Intergenic
1111688165 13:91527409-91527431 GTCCAGGGCACACTGATGGAAGG + Intronic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1115429737 14:33302296-33302318 TCTCAGAGCACAGTGTTGAAAGG + Intronic
1117192625 14:53307791-53307813 GTTGAGAGCAAACTGATGGATGG + Intergenic
1117763933 14:59060604-59060626 GCTCAGAGCAGAGTGCAGAATGG + Intergenic
1118915525 14:70099890-70099912 ACTTAGAGCACAATGCTGTAAGG - Intronic
1119188588 14:72663103-72663125 GCAGAGAGAACACAGCTGGATGG + Intronic
1121385169 14:93514526-93514548 GCTCAGAGCAAACTTCTGCAAGG - Intronic
1122342135 14:101035342-101035364 GGTCAGAACCCACTTCTGGAAGG + Intergenic
1124166149 15:27327670-27327692 GCTCAGAGGACACTGCTGGAGGG - Intronic
1124383366 15:29186231-29186253 GCAGAGACCACACAGCTGGAAGG + Intronic
1124609998 15:31201607-31201629 GCTCACAGCTCACTGCTGGGTGG - Intergenic
1124631049 15:31337379-31337401 CCTCAGAACACACAGCTGCAAGG - Intronic
1126069137 15:44850509-44850531 GCTCAGACCACACTGCTCCTGGG + Intergenic
1126089674 15:45040264-45040286 GCTCAGACCACACTGCTCCTGGG - Intronic
1128578375 15:68791555-68791577 GCTCAGATGACGCTGCAGGAGGG + Intronic
1130018001 15:80202130-80202152 GCTCAGACCACCCTGCAGGAGGG + Intergenic
1130373330 15:83305905-83305927 GCTCAGAGGACACTTCAGGGTGG + Intergenic
1130677731 15:85968488-85968510 ACTCAGGGCACACAGCTGGAGGG - Intergenic
1131048104 15:89328921-89328943 GGTGAGAGCACACTGCCGGTGGG - Exonic
1131229534 15:90649637-90649659 GCTCAGAGCCCACCTCTGCAGGG - Intergenic
1131825920 15:96322489-96322511 GCCCAGAGCACACTCCGGGCTGG - Intergenic
1132453020 15:101978602-101978624 GCTCAGACCAGCCGGCTGGAGGG - Intergenic
1132453872 16:12024-12046 GCTCAGACCAGCCGGCTGGAGGG + Intergenic
1133331374 16:4976701-4976723 GCCCAGAGCCCACAGCTGCAGGG - Intronic
1138276435 16:55738262-55738284 GCCCAGAGCCCACTGCAGGCAGG + Intergenic
1139476591 16:67205857-67205879 GCTCAGCCCTCAGTGCTGGAGGG + Intergenic
1141672106 16:85497576-85497598 TCTCACAGCAAACTGCTGAAAGG + Intergenic
1141913649 16:87077866-87077888 GCTCTGGGCACACTGCTGTGGGG + Intergenic
1141986575 16:87584214-87584236 CCTCAGAGCTCACTGCTGTCTGG - Intergenic
1143327553 17:6109449-6109471 GCACAGAGCACAGTGGTGGAAGG + Intronic
1143919213 17:10317597-10317619 GCTCAGAGCACCCTGCAAGGAGG + Intronic
1144732712 17:17537743-17537765 GCACAGGTCATACTGCTGGAAGG - Intronic
1146325962 17:31886235-31886257 CCTCAGAGAACACAGTTGGAAGG - Intronic
1147214950 17:38893625-38893647 TCTCAGACCACACAGCTGGTGGG - Intronic
1148862745 17:50613062-50613084 GCCCAGAGGACACCCCTGGATGG - Intronic
1151359704 17:73581540-73581562 GCTCAGCGCCCACTGCTGTCAGG - Intronic
1152037849 17:77884247-77884269 GCACAGAGCTCACTGCTGGCTGG - Intergenic
1152246073 17:79185196-79185218 GGTCAGACCACACGGCTAGATGG - Intronic
1152249637 17:79205070-79205092 AGTCAGAGCCCACTGGTGGAAGG + Intronic
1152513899 17:80809980-80810002 GATCTCAGCTCACTGCTGGACGG - Intronic
1152569506 17:81115495-81115517 GCCCAGCCCACACTGCTGGGAGG + Intronic
1153108820 18:1560017-1560039 GCTCAGAGCAGACAGCTCTATGG + Intergenic
1153280487 18:3410067-3410089 GCTCAGAGCAGTCTGTTGGCAGG + Intergenic
1155144788 18:23074337-23074359 GTTCAGAGCAAAGTTCTGGAAGG - Intergenic
1161391968 19:4025740-4025762 GCTCTGAGCACTCTGCAGCAGGG - Intronic
1163176382 19:15566639-15566661 ACTCAGAGCTCACTTCTAGAGGG - Intergenic
1163257870 19:16168446-16168468 GCTCAGATCACAGGGGTGGAGGG - Intronic
1163328453 19:16620318-16620340 GCTCAGCGGACACAGCTGGAAGG - Intronic
1165337566 19:35182500-35182522 GAACAGAGCCCACTGCTAGAGGG + Intergenic
1165981239 19:39726225-39726247 GCTCAAAGCACACAGCAGGTTGG + Intergenic
1167263728 19:48473105-48473127 GCTCAGAACACACTCTTGGGAGG - Intronic
1167775065 19:51549374-51549396 GAACAGTGCACACTGCTGGAGGG + Intergenic
927428911 2:23009809-23009831 GCCCAGGCCACACTGCAGGAGGG + Intergenic
927441015 2:23117941-23117963 GCTCAAAGCACACAGCAGGCAGG + Intergenic
930060848 2:47287180-47287202 CCACAGAGCACAGGGCTGGAAGG - Intergenic
931994240 2:67824420-67824442 GCGCAGAGCTCTGTGCTGGAGGG + Intergenic
936251930 2:110874019-110874041 GCCCAGAGCACTGTGCTGGGTGG + Intronic
936539394 2:113337620-113337642 ACTTAGAGCACACAGCTGTAGGG + Intergenic
936569236 2:113601074-113601096 GCTCAGACCAGCCGGCTGGAGGG - Intergenic
936619847 2:114084179-114084201 GCTCAGAGGAAACTGCTTTATGG - Intergenic
937238796 2:120447050-120447072 GCTCAGGGCATAGTTCTGGAAGG + Intergenic
937493064 2:122389731-122389753 ACCCAGGGCACACTGATGGAAGG + Intergenic
938303132 2:130230093-130230115 CCCCAGAGCAGGCTGCTGGACGG - Intergenic
941652940 2:168112917-168112939 GGCCAGAGCACACTGGTGGACGG - Intronic
942004072 2:171679980-171680002 GCTCAGAGCCCATAGCTGCAGGG - Intergenic
943719203 2:191185329-191185351 GCCGAGAACACACTGCTGGAGGG - Intergenic
946100295 2:217314756-217314778 CATCAGTGCATACTGCTGGAGGG + Intronic
947316726 2:228866726-228866748 GCTGAGAGCTGAATGCTGGATGG + Intronic
947477847 2:230467265-230467287 GCTCAGAGCACAGTGCATCAGGG - Intronic
947545012 2:231004331-231004353 GGACAGAGCTCACTGCTGGGGGG + Intronic
949050992 2:241897094-241897116 TGTCAGGGCACACTGCTGGCGGG + Intronic
1170893663 20:20396046-20396068 GCCCAGAGCGCTCTGATGGATGG - Intronic
1171171003 20:23015340-23015362 GCTCTGGGCACACTGCCTGAAGG - Intergenic
1173314455 20:41930956-41930978 ACCCAGAGCACATTGGTGGAAGG + Intergenic
1174085859 20:48006763-48006785 GCCCAGAGCCCAGGGCTGGAGGG + Intergenic
1174130398 20:48340187-48340209 GCCCAGAGCCCAGGGCTGGAGGG - Intergenic
1175220443 20:57413699-57413721 ACTCAAAGCTTACTGCTGGAAGG - Intergenic
1175376112 20:58525071-58525093 GCTGAGATCATACTGGTGGATGG - Intergenic
1175602917 20:60289533-60289555 ATTCAGAGCACACTGGTGCAGGG + Intergenic
1177867699 21:26532446-26532468 GATAAGAGCATTCTGCTGGATGG - Intronic
1178314879 21:31559295-31559317 GCTCGGAGCGCGCGGCTGGAGGG + Intronic
1178697780 21:34808932-34808954 CTTCAGTGCACACAGCTGGAGGG + Intronic
1179044394 21:37831725-37831747 GCTCAGCTCACCCTGCAGGAGGG + Intronic
1179437130 21:41369680-41369702 GCTGAGAGCGCCCTGCAGGAAGG - Intronic
1179893225 21:44348176-44348198 CCTCAGAGGACACTCCAGGAAGG - Intergenic
1179955947 21:44738697-44738719 GCTCAGAGGTCTCTGCAGGAAGG - Intergenic
1181361411 22:22340254-22340276 GCTCAGTGCAAACAGCTGAATGG + Intergenic
1181804621 22:25367282-25367304 GCACAGCTCACACTGCTGGCAGG - Intronic
1181811997 22:25408954-25408976 GCCCAAAGCACACTACTGCAAGG + Intergenic
1183583426 22:38738821-38738843 GCTCTGAGCACACTGAGGGCTGG - Intronic
1184716698 22:46286768-46286790 CCTCAGACCACACTGGTGGGAGG - Intronic
1184801479 22:46762957-46762979 ACTCTGAGGAGACTGCTGGATGG + Intronic
949576367 3:5342663-5342685 GCACATAGCACAGTGCTTGATGG - Intergenic
949688114 3:6601080-6601102 GCTCAGAGCAGAGGGCTAGATGG + Intergenic
950865194 3:16183140-16183162 TCTCACAGCTCACTTCTGGAGGG - Intronic
954145869 3:48634025-48634047 GCTGAGAGCACACTCAGGGAAGG + Intronic
954709939 3:52500558-52500580 GCTCAGAGCAGAGTGGTGGCTGG + Intronic
956514741 3:70034481-70034503 CCACAGATCAAACTGCTGGAGGG - Intergenic
960461254 3:117938687-117938709 ACTCAGAGCTCACATCTGGATGG - Intergenic
961635377 3:128329744-128329766 CCTCAGGGCAGGCTGCTGGATGG - Intronic
962267580 3:133954774-133954796 CCTCAGATCACACAGCTGGGAGG + Intronic
966555153 3:181250857-181250879 CTACAGAGCACACTGCTGTAAGG - Intergenic
966568011 3:181404677-181404699 TCTCAGAGCAGTCTGCTGCAGGG - Intergenic
968394117 4:217465-217487 TCACAGAGCACTCTGCTGGGAGG - Intergenic
968770184 4:2500456-2500478 ACTCAGAGCAGAATTCTGGAAGG + Intronic
969657587 4:8507120-8507142 GCTCAGCCCCCACAGCTGGATGG + Intergenic
971527490 4:27639316-27639338 GCTCAAAGCAAACTGCCGTAAGG - Intergenic
971528439 4:27653017-27653039 TATAAGAGCACACTGTTGGAAGG + Intergenic
971875825 4:32307107-32307129 GCTCAGTGAACACTGCTTTATGG + Intergenic
973284860 4:48403700-48403722 GCCCAGAGAACACTGCTGCCTGG + Intronic
973780330 4:54282958-54282980 GTCCAGAGCACACTGATGCAAGG + Intronic
975520119 4:75291600-75291622 GCACAGAGCCCAGTGCTGGGAGG + Intergenic
975833595 4:78397329-78397351 GCTCTCAGCACCCTGCTTGATGG - Intronic
979669275 4:123345122-123345144 GCTCAGCCCACCCTGCAGGAGGG - Intergenic
981341167 4:143623335-143623357 GTTCAGAGCACACTAATGCAGGG + Intronic
984981782 4:185289158-185289180 GCTCAGTAAACACTGCTGAATGG - Intronic
986646580 5:9921921-9921943 GCTCAGAGCACACTGAAGGCTGG + Intergenic
988788932 5:34589722-34589744 GCCCAGAGCAGAGTGCAGGAGGG - Intergenic
991491811 5:67191244-67191266 GCTCAGAGAACACAGCTTGGTGG - Intronic
991497701 5:67243644-67243666 GCTCAGAGCAGTGAGCTGGAAGG + Intergenic
992448570 5:76855437-76855459 TCTCAGGGCACACTGCTGCAAGG - Intronic
995859309 5:116624955-116624977 TCTCAGATCACCCTGCTGGATGG + Intergenic
997411928 5:133697178-133697200 GCTGAGCCCACACTGCTGGCAGG + Intergenic
997439782 5:133901058-133901080 GCTCTGAGCATACTGATGGGGGG + Intergenic
998140316 5:139696391-139696413 GCTCAGGGCCAGCTGCTGGAAGG - Intergenic
999132437 5:149294756-149294778 GCCCAGAGCACTCCACTGGAGGG + Intronic
999906817 5:156150071-156150093 TCTAACAGCACACTTCTGGAGGG - Intronic
1000393728 5:160751022-160751044 GCACAGGGCACACTGCAGGCAGG - Intronic
1000830241 5:166093453-166093475 ATTCAGGGCACACTGCTGCAAGG + Intergenic
1002438890 5:179253740-179253762 GGTCTGAACTCACTGCTGGAGGG - Intronic
1004192758 6:13478546-13478568 GCGGAGACCACCCTGCTGGAGGG - Intronic
1006375957 6:33671721-33671743 GCTGAGAGGACACTGCGGGGAGG - Intronic
1007610696 6:43147026-43147048 GCTCAGAGCTCATTGCAGGTGGG - Intronic
1007736867 6:43987383-43987405 GGTGAGAGCCCACTGCTGGATGG - Intergenic
1008376425 6:50796916-50796938 GCTACGATCACACTGCTGCAGGG + Intergenic
1010146286 6:72673199-72673221 GCACAGAGCACAAAGCTGAAGGG - Intronic
1013976012 6:116079696-116079718 GCTCAGGGCACACAGTGGGAGGG - Intergenic
1015256276 6:131183078-131183100 ACACAGAGCCCTCTGCTGGATGG - Intronic
1018186702 6:161271383-161271405 GAGCAGAGCACCCAGCTGGAAGG - Intronic
1022498967 7:30870879-30870901 GCTCTGAACACAGTGCTGGGTGG + Intronic
1022781662 7:33591101-33591123 GCTCAGCCCACAATCCTGGAAGG + Intronic
1023993743 7:45146208-45146230 GCTGAGAGGACACTTCTGTAGGG - Intergenic
1024311527 7:47973995-47974017 GCACAGTGCACACTGCTTCATGG + Intronic
1030816886 7:114049639-114049661 TCTCAGCTCACACTGATGGATGG + Intronic
1031077663 7:117228330-117228352 GCTCAAAGCCCAGTGATGGAGGG - Intronic
1032368483 7:131323266-131323288 GTTCAGATCACAGGGCTGGAAGG + Intronic
1032521003 7:132545143-132545165 GCACAGAGGACACTGGGGGAGGG - Intronic
1033571355 7:142631956-142631978 ACTCTGTTCACACTGCTGGAGGG - Intergenic
1034074508 7:148218814-148218836 TCTCAGAGGTCACTGCTGAAGGG - Intronic
1034420819 7:150989666-150989688 CATCAGAGCACCCTGATGGAAGG + Intergenic
1036811814 8:11872255-11872277 GCTCATACCTCCCTGCTGGAAGG - Intergenic
1037858492 8:22388499-22388521 GGCCATAGCACATTGCTGGAGGG + Intronic
1038213149 8:25538867-25538889 GCCCAGATCACACTGATGGCGGG + Intergenic
1039848088 8:41340350-41340372 GAACAGAGGACTCTGCTGGAAGG - Intergenic
1040531393 8:48269210-48269232 GGTCAGGGCTCACTGATGGAGGG + Intergenic
1045561381 8:103267213-103267235 GGTCAGAGCAAGCTGATGGAGGG - Intergenic
1045655820 8:104385431-104385453 CCTGAGAACACACTGTTGGAAGG + Intronic
1047571060 8:126099097-126099119 GCTCCAAGGAGACTGCTGGAGGG + Intergenic
1049883291 9:12456-12478 GCTCAGACCAGCCGGCTGGAGGG + Intergenic
1049920942 9:363704-363726 CCACCGAGCACACAGCTGGAAGG - Intronic
1052012339 9:23425144-23425166 CCTGAGAGCACACTACAGGAAGG - Intergenic
1052883734 9:33623407-33623429 ACTCTGTCCACACTGCTGGAGGG - Intergenic
1052924435 9:34003101-34003123 GCCGAGAGCACACTACTGCAAGG - Intronic
1053585346 9:39452230-39452252 GCTGAGATCACACTACTGAAGGG - Intergenic
1054580969 9:66912994-66913016 GCTGAGATCACACTACTGAAGGG + Intronic
1054803897 9:69379833-69379855 GCTCAGAGCACACTGCTGGATGG - Intronic
1056862480 9:90198972-90198994 GCCCAGGGGGCACTGCTGGAGGG - Intergenic
1059859214 9:118439281-118439303 GATCCTAGCACAATGCTGGAAGG + Intergenic
1203496680 Un_GL000224v1:158204-158226 GCTCATATCACACTGCTGCGTGG - Intergenic
1203509303 Un_KI270741v1:100126-100148 GCTCATATCACACTGCTGCGTGG - Intergenic
1187399873 X:18950213-18950235 GCTCTGGGCACACTGCTGAGTGG + Intronic
1189245431 X:39560015-39560037 GCTCAGCCCACACTGCAGGTGGG + Intergenic
1189373958 X:40451844-40451866 ACTCAGAGGCCACTGCTGCATGG - Intergenic
1190915703 X:54809598-54809620 GGTCAGAGCACACCGCAGGTAGG + Intronic
1192299179 X:69882197-69882219 GCTCAGAATGCAATGCTGGAAGG - Intronic
1196390576 X:115203694-115203716 ATCCAGAGCACACTGATGGAAGG + Intronic
1196930142 X:120673955-120673977 GATAAGAGCTCACTGCTGGGTGG - Intergenic
1197119313 X:122871319-122871341 GCTCAGAGAAGGCTTCTGGAAGG + Intergenic
1200402522 X:156027692-156027714 GCTCAGACCAGCCGGCTGGAGGG - Intergenic