ID: 1054804728

View in Genome Browser
Species Human (GRCh38)
Location 9:69386926-69386948
Sequence CCCACAGTGAAGGCAGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 213}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054804728_1054804738 22 Left 1054804728 9:69386926-69386948 CCAAGACCTGCCTTCACTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 213
Right 1054804738 9:69386971-69386993 GTTGAGGACTCCAGCCTCAACGG 0: 1
1: 1
2: 1
3: 6
4: 125
1054804728_1054804739 23 Left 1054804728 9:69386926-69386948 CCAAGACCTGCCTTCACTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 213
Right 1054804739 9:69386972-69386994 TTGAGGACTCCAGCCTCAACGGG 0: 1
1: 0
2: 2
3: 15
4: 123
1054804728_1054804734 6 Left 1054804728 9:69386926-69386948 CCAAGACCTGCCTTCACTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 213
Right 1054804734 9:69386955-69386977 ACACCCTACCTGGCAAGTTGAGG 0: 1
1: 0
2: 0
3: 9
4: 124
1054804728_1054804732 -4 Left 1054804728 9:69386926-69386948 CCAAGACCTGCCTTCACTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 213
Right 1054804732 9:69386945-69386967 TGGGTCTCCTACACCCTACCTGG 0: 1
1: 0
2: 1
3: 10
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054804728 Original CRISPR CCCACAGTGAAGGCAGGTCT TGG (reversed) Intronic
900431079 1:2603482-2603504 CCCTCAGGGCAGGCAGGACTGGG + Intronic
900464770 1:2820414-2820436 CCTGAAGTGAAGGCAGGTCCTGG - Intergenic
900897559 1:5494274-5494296 CCCACAATGAAGGCTGCTTTTGG + Intergenic
900944383 1:5821623-5821645 CCCACAGAGTAGGCAGGCTTAGG - Intergenic
900955405 1:5883592-5883614 CCCACAGTGAATGGAGGTGCTGG - Intronic
900955416 1:5883637-5883659 CCCACAGTGAAGGGAGGTGCCGG - Intronic
901222312 1:7590188-7590210 CTCACAATCAAGGCAGCTCTAGG + Intronic
902521035 1:17016705-17016727 CACACAGATAAGGGAGGTCTTGG + Intergenic
903767122 1:25742017-25742039 CCCACAGTGCAGGGAGGTAGTGG + Intronic
903811477 1:26037126-26037148 CAGCCAGTGCAGGCAGGTCTGGG - Intergenic
904291305 1:29487781-29487803 GCCACAGTGAAGGCTGGGGTAGG + Intergenic
904818235 1:33221264-33221286 CCCACAGTCAGGACAGGTCCTGG - Intergenic
905251882 1:36654505-36654527 TGCACAGGGAAGGCAAGTCTTGG - Intergenic
905874302 1:41422456-41422478 CCCAGGATGAAGGCAGGTGTTGG + Intergenic
907734599 1:57099897-57099919 CCCCCAGTTAAGGCAGGTACAGG - Intronic
907847671 1:58224030-58224052 CCCACAGTTGAGGCAGGTAGTGG - Intronic
913942352 1:125119977-125119999 CCCAAGGTGAGGGCTGGTCTCGG - Intergenic
916388843 1:164307743-164307765 TCCACAGTGATGGCATGGCTGGG + Intergenic
916508178 1:165446702-165446724 GCAACAGTCAAGGCAGCTCTGGG - Intergenic
917014104 1:170510341-170510363 TCCACAGAGAAGGGAGCTCTTGG + Intergenic
917473760 1:175350418-175350440 CCCACAGAGCAGCCAGGACTTGG - Intronic
919445971 1:197705823-197705845 CCTACAGTGAAGACATGACTTGG - Intronic
922062616 1:222106609-222106631 CCCATCGTGGAGGCAGGTGTTGG - Intergenic
922173550 1:223177536-223177558 TACACAGTGGAGGCAGGTGTGGG - Intergenic
922193816 1:223342107-223342129 GCCACAGTGAAACCAGGGCTAGG + Intronic
922247315 1:223813210-223813232 TCCAGAATGAAGGCAGGACTTGG - Intronic
922517293 1:226217371-226217393 CCCAAAGTGAATGCAGATTTGGG + Intergenic
923004545 1:230036491-230036513 CCCACAGTAACGGTAGGCCTTGG - Intergenic
1064179574 10:13102479-13102501 GCCACATAGAAGGCAGGACTCGG - Intronic
1067088362 10:43254437-43254459 CCCACAGGGCTGGAAGGTCTGGG - Intronic
1067101815 10:43339531-43339553 CCCACAGAGATGCCAGGGCTAGG + Intergenic
1068939034 10:62662779-62662801 CACACAGGGAAGACAGTTCTGGG + Intronic
1070049484 10:72873306-72873328 ACCACAATGAAGGCAGGGCACGG - Intronic
1070794516 10:79209036-79209058 TCCACAGTGAAGGCAGCACAGGG + Intronic
1073639037 10:105230587-105230609 CCCACAGTAATGGCAGCTATGGG + Intronic
1074436160 10:113436239-113436261 ACCACAGTGCAGTCAGGTCAAGG - Intergenic
1075715010 10:124550907-124550929 CCCACAGAGGAGGCTGGTCCAGG + Intronic
1075810003 10:125218448-125218470 CCTACCCTGAAGGCAGCTCTGGG + Intergenic
1076544858 10:131238446-131238468 CCCACACTCAAGGCAGCACTGGG + Intronic
1076834274 10:133013196-133013218 CCCACAGTGAAGATGGGTCAGGG + Intergenic
1076921742 10:133457903-133457925 CACACAGTTGAGGCAGGGCTGGG - Intergenic
1077110963 11:862082-862104 CCCGGAGTGAGGGCAGGGCTGGG + Intronic
1077707072 11:4497188-4497210 GCCACAGGGAAGGCAGGTATTGG + Intergenic
1078102341 11:8337388-8337410 CCCACAGGGAAGGAAGGAGTGGG - Intergenic
1079244553 11:18743058-18743080 CCCAGAGTCAAGCCAGGCCTGGG + Exonic
1081662069 11:44894387-44894409 CCCCCAGTGGAGGAAGGTTTGGG - Intronic
1082241496 11:49876488-49876510 CCCACTGTGCTGGTAGGTCTTGG - Intergenic
1082610585 11:55292193-55292215 CCCACTGTGCTGGTAGGTCTTGG + Intergenic
1083662947 11:64260241-64260263 CCCACAGGGTGGGCAGGTCGGGG + Intronic
1083755130 11:64788235-64788257 CCTACATTCAAGGCAGGTGTTGG - Intergenic
1083784093 11:64933973-64933995 CCCCCAGTGAAAGCTGGGCTGGG - Exonic
1084271051 11:68029457-68029479 CCTAGAGAGAAGGGAGGTCTTGG - Intergenic
1085701885 11:78752800-78752822 CCCAGAGAGGAGGCAGGTTTAGG - Intronic
1085978644 11:81694024-81694046 TCCACAGTGAAGGCAGCTGAGGG - Intergenic
1087920391 11:103860536-103860558 CCCTGAGTGTAGCCAGGTCTGGG + Intergenic
1088164616 11:106918313-106918335 CCCACATTGAATGCAGCACTTGG + Intronic
1096355417 12:50937334-50937356 CCCAAGCTGGAGGCAGGTCTTGG - Intergenic
1104544774 12:129700683-129700705 CCCACAGTGACGGAAGGTCGAGG - Exonic
1105799543 13:23891671-23891693 CCCACAGTGAAAGCACTTTTTGG + Exonic
1105849503 13:24321364-24321386 CCCACAGTGAAAGCACTTTTTGG - Exonic
1106000616 13:25719833-25719855 CCCACAGCGATGCCAGCTCTGGG - Intronic
1115447539 14:33508765-33508787 ACCACAGTTAAGGGAGGCCTAGG - Intronic
1115874286 14:37843468-37843490 CTCACAGTGAACACAGGTTTCGG - Intronic
1118628885 14:67685056-67685078 GGCACAGTGCAGGCTGGTCTGGG + Exonic
1118840345 14:69505193-69505215 CCCACCATGAAGGCTGTTCTGGG + Intronic
1122627872 14:103093542-103093564 CCCACAGTCAAGGCATGTGTGGG - Intergenic
1123687220 15:22807328-22807350 CCTACAGTGAAAGCTGGTCAAGG - Intronic
1123707978 15:22964464-22964486 CCCAGCAAGAAGGCAGGTCTTGG + Intronic
1125325564 15:38532963-38532985 CCTACAGTGAAGGCTTGTCTGGG + Intronic
1126612709 15:50545998-50546020 CTCTCTGTGCAGGCAGGTCTGGG - Intronic
1127556852 15:60095850-60095872 CCCACAGTGCAGCCATGTGTGGG - Intergenic
1129540492 15:76343533-76343555 CACTAAGTGAAGGCTGGTCTTGG - Intergenic
1131218593 15:90561515-90561537 CCCACAGAGAAGGCACATGTGGG + Intronic
1132634778 16:938363-938385 CTCACAGGGAAGGCAGGGATGGG + Intronic
1132746630 16:1438928-1438950 CCCACAGAGAATGAAGGCCTCGG - Exonic
1132985134 16:2762171-2762193 CCCAGAGAAGAGGCAGGTCTAGG + Exonic
1134219025 16:12338793-12338815 CCCACATGGAAGGTGGGTCTGGG - Intronic
1135491946 16:22916926-22916948 GACACAGTCAAGGCAGGGCTGGG - Intergenic
1136387835 16:29941083-29941105 CCCCCAGAGAAGGCAGGAGTGGG + Intronic
1138113151 16:54340297-54340319 CCCACCACTAAGGCAGGTCTGGG + Intergenic
1138961898 16:62037242-62037264 ACCACAGACAGGGCAGGTCTTGG - Intergenic
1139577177 16:67849046-67849068 TCCAGAGAGAAGGCAGGGCTTGG - Intronic
1143962227 17:10730123-10730145 CCCTCAGGGAGCGCAGGTCTCGG + Exonic
1144670828 17:17131730-17131752 CCCTCAGTGGAGCCAGGGCTTGG + Intronic
1145992181 17:29085878-29085900 CCCATCCTGCAGGCAGGTCTGGG - Intronic
1148352569 17:46951263-46951285 CCCACAGTGAAGTCTGGTAGGGG + Intronic
1149304788 17:55336930-55336952 CCCATAGTGTAGGCAGTTCAGGG + Intergenic
1151400893 17:73855336-73855358 CCCACAGTGAGGCCACGTCTTGG + Intergenic
1151492819 17:74442909-74442931 CCCACACTGAATGCCGGTCGGGG + Intronic
1151714088 17:75822710-75822732 CACTCTGTGAAGGAAGGTCTTGG - Intronic
1151954835 17:77374987-77375009 CCCAGAGGGAGGGGAGGTCTGGG + Intronic
1152800156 17:82327136-82327158 CTCAGAATGAAGGTAGGTCTCGG - Exonic
1153642383 18:7167976-7167998 CCCTCTGTGAAAGAAGGTCTTGG - Intergenic
1154274042 18:12944582-12944604 CCTACAGTGAAGGCTGGGCGTGG - Intergenic
1156646678 18:39170951-39170973 TGCACAGTCAAGGCAGATCTTGG - Intergenic
1158610294 18:58934515-58934537 CCCACACTCAGGGCAGGTGTAGG - Exonic
1159762582 18:72447148-72447170 CCCAGAGTCAAAGTAGGTCTGGG - Intergenic
1160183332 18:76655049-76655071 TCCACAGTCAAGGCAGATTTGGG + Intergenic
1160243054 18:77136636-77136658 GGCACCGTGGAGGCAGGTCTGGG - Intergenic
1161914421 19:7218005-7218027 CCCACAGTGGAGACAGCTCTGGG - Intronic
1162060908 19:8094632-8094654 CACACAGTGATTGCAGGTGTTGG - Intronic
1163432675 19:17277598-17277620 CCCACAGCTAATTCAGGTCTGGG - Intronic
1163697893 19:18773213-18773235 TGCAGAGGGAAGGCAGGTCTCGG - Intronic
1168406890 19:56115112-56115134 CCCTCAGGGAGGGCAGGCCTGGG - Intronic
1168459477 19:56541383-56541405 CCCACAGTAAAAGGAGGACTTGG - Intronic
1168713503 19:58514512-58514534 CCCAACGTGAAGGGAGGTCCTGG - Intronic
925166114 2:1716688-1716710 CCCACAGTGAGGTCCTGTCTGGG + Intronic
926113468 2:10196825-10196847 CTCAGAGTGAAGACAGGGCTGGG + Intronic
928605153 2:32938699-32938721 ACCAGAATTAAGGCAGGTCTTGG - Intergenic
929057068 2:37887474-37887496 ACCACAGTGGAGGGATGTCTTGG + Intergenic
930442285 2:51424634-51424656 CCCAGAGTCAAGGCAGGTACAGG - Intergenic
930759921 2:55022700-55022722 CCCAGGGTGATGGCAGGACTAGG - Intronic
933866521 2:86523177-86523199 CCAACACGGAAGGAAGGTCTGGG - Intronic
936025146 2:109025992-109026014 CCCCCAGGGAGGGCAGGCCTTGG - Intergenic
936156374 2:110049935-110049957 CTGACAGAGAAGGCAGGTGTAGG + Intergenic
937400354 2:121577542-121577564 CCCACAGTGTGGGCATCTCTGGG + Intronic
937891596 2:126943256-126943278 CTCCCAGTGAAGGCATGTCTGGG - Intergenic
943661479 2:190563870-190563892 CCCACAGAGTAGGGAGGCCTTGG - Intergenic
946160216 2:217831325-217831347 CCCACACTGAGGTCAGGCCTGGG - Intronic
946514620 2:220398138-220398160 CCCAGACTGGAGGCAGGCCTAGG - Intergenic
947591976 2:231391020-231391042 CTCAAAGTGTAGGCAGGTTTGGG - Intergenic
948431294 2:237920783-237920805 CTCACAGTGAAGACAGCCCTTGG + Intergenic
1169022612 20:2340815-2340837 CTCACAGAGCAGGCAGCTCTGGG - Exonic
1169474282 20:5916928-5916950 CCCACACGGCAGGCAGATCTTGG + Intronic
1170899750 20:20450595-20450617 CCCACAGCCAGGGCAGGGCTGGG - Intronic
1170945520 20:20887860-20887882 CACACAGGGTAGGCAGGGCTCGG - Intergenic
1175965996 20:62660548-62660570 CCCAATGTGAAGGCTGGGCTGGG - Intronic
1175985250 20:62761211-62761233 CCCACCCTGAAGCCAGCTCTGGG - Exonic
1178139705 21:29668893-29668915 TCCACATTGAAGGCAGGTTAAGG + Intronic
1178367565 21:32000033-32000055 CCCACAGGCAGGGCAAGTCTCGG + Exonic
1178460679 21:32799454-32799476 CACACTGTGAAGCCAGGACTTGG - Intronic
1179155499 21:38847464-38847486 CCCACAGTCAAGGCTGCACTGGG - Intergenic
1180127096 21:45800266-45800288 CCCACAGAGACAGCAGGTCCAGG + Intronic
1181040399 22:20189630-20189652 CCCACAGAAAAGGCATGTATTGG + Intergenic
1181386264 22:22548124-22548146 CCCACAGTGAGGACAGGGGTTGG + Exonic
1181576508 22:23798650-23798672 CCCAGAGTCCAGGCAGGTCTTGG + Intronic
1183617600 22:38954878-38954900 CCCACAGTGATGGCAGAGCCAGG + Intronic
1184113677 22:42409791-42409813 CCCACAGGGGAGCCAGGTCACGG - Intronic
1184688154 22:46105653-46105675 CCCAGGGTGAAGGCAGGGCCTGG - Exonic
1184756410 22:46518456-46518478 CCCACTGAGAAGGGAGGCCTCGG + Intronic
1185284859 22:49995653-49995675 CGCACAGTGGGGGCAGGGCTGGG - Exonic
949562403 3:5214713-5214735 CCCACAGTGGAGCCAGGATTTGG + Intronic
952945524 3:38476043-38476065 CCCACAATGGAGGCAGGTGGTGG - Intronic
953961747 3:47271415-47271437 CGCACAGTGATGGCATGTGTGGG + Exonic
954003700 3:47577097-47577119 CCCACTGGGAAGCCTGGTCTGGG - Exonic
955073496 3:55591484-55591506 CCCAGGGCGAAGGCAGGGCTTGG + Intronic
963059413 3:141212752-141212774 CAGACAGTGAAGGCAGGTGCTGG + Intergenic
964925526 3:161951940-161951962 GCCACAGAGAAGCCAGGACTTGG + Intergenic
968693707 4:2009658-2009680 CCCACAGTGCAGGGAGGCCCCGG + Exonic
968735353 4:2292242-2292264 CCCACCTTGAAGGCAGCTGTGGG + Intronic
968946402 4:3666849-3666871 CCCACAGGGAAAGGAGGTCATGG + Intergenic
969251267 4:5970295-5970317 CCCTCAGGGAAGGCTGTTCTCGG - Intronic
975661980 4:76697308-76697330 CCCAGAGTTGAGGCAGGACTTGG + Intronic
982455399 4:155603655-155603677 CCCACACTGGAGACAGGGCTAGG + Intergenic
983111951 4:163761671-163761693 CCCACAGTGAAGGGAATTCTGGG + Intronic
983203357 4:164886168-164886190 CCCATATTTAAGGCAGTTCTTGG - Intronic
985622190 5:961512-961534 CCCCCAGTGCTGGCAGGTCGCGG + Intergenic
985652839 5:1114946-1114968 CCCACAGGAAAGGCAGGGCAAGG + Intergenic
986181873 5:5400615-5400637 CCTACAGAGAAGGCAGCTGTCGG + Intergenic
986725674 5:10594755-10594777 CCCACATCGCAGGCAGCTCTGGG - Intronic
988941762 5:36154147-36154169 CCAAGAGGGAATGCAGGTCTTGG + Intronic
990997290 5:61745492-61745514 CTCATACTGAAGGCAGGGCTTGG - Intronic
991036329 5:62131428-62131450 CTCCCAGGGAAGGCAGGGCTGGG + Intergenic
993837643 5:92835037-92835059 CCCACAGGGAGGCCTGGTCTGGG + Intergenic
995091993 5:108189039-108189061 CCCACAGTCATGGCTGGGCTTGG + Intronic
996684599 5:126266553-126266575 ACCACAGTGAAGGATGGGCTTGG - Intergenic
997655868 5:135553959-135553981 TCCAGAGTGAATGCAGGGCTTGG - Intergenic
1001414039 5:171530736-171530758 CCCACAGACAAGGCAGCACTGGG - Intergenic
1001543990 5:172558721-172558743 CACACTGGGAAGGCAGGGCTCGG + Intergenic
1002345308 5:178544430-178544452 CCCACCGCCATGGCAGGTCTTGG - Intronic
1002873461 6:1188965-1188987 ACCAAAGTGAAGGGAGGTCTGGG - Intergenic
1003554820 6:7130144-7130166 CCCCCAGTGAGGGCAGGTGAAGG - Intronic
1005880081 6:30050429-30050451 ACCACAGTGAAGGCTGGGCATGG + Intergenic
1005899589 6:30206053-30206075 CCCACAGGGAATGGAGCTCTAGG - Intronic
1010696800 6:78985351-78985373 GGCACAGTGATGGCAGTTCTAGG - Exonic
1011470478 6:87702612-87702634 CCCACAGTGATTTCAGATCTGGG + Intergenic
1012230608 6:96756981-96757003 CCTACAGTGAAGCCACCTCTGGG + Intergenic
1013623189 6:111910103-111910125 CCCACAGAAATGGCAGGACTTGG - Intergenic
1014931354 6:127340408-127340430 CCCAAATTGAAGGCAGCCCTAGG - Intronic
1015305911 6:131708260-131708282 ACCACAGTGAATACAGTTCTTGG + Intronic
1016669984 6:146693378-146693400 CACACAGAGAAGGCAGCTGTTGG + Intronic
1017118049 6:150997180-150997202 CCTACAGGAAAGACAGGTCTTGG - Intronic
1019788876 7:2997420-2997442 CCCACAGGGGAGGCAGGGCGAGG + Intronic
1022498548 7:30868299-30868321 CACACAGAGTAGGCAGGACTAGG - Intronic
1022958074 7:35399539-35399561 CCCACATTGGAGGCAGAGCTGGG + Intergenic
1023740919 7:43279917-43279939 TCCCCAGTGAAGGGAGCTCTTGG - Intronic
1023850995 7:44150311-44150333 CCCAGAGTCAAGGCAGGGCGTGG + Intronic
1026593976 7:71718811-71718833 CCTACAGTGAAGGCTGGGCAAGG + Intergenic
1028621320 7:92832792-92832814 CCCACCCTGAAGGAGGGTCTGGG - Intronic
1033679067 7:143574545-143574567 ACCACAGTGAATACAGTTCTTGG - Intergenic
1033692771 7:143754909-143754931 ACCACAGTGAATACAGTTCTTGG + Intergenic
1033731639 7:144186239-144186261 ACCACAGTGAATACAGTTCTTGG - Exonic
1033740026 7:144266493-144266515 ACCACAGTGAATACAGTTCTTGG + Intergenic
1034254363 7:149716174-149716196 CCCACTGGGAGAGCAGGTCTAGG + Intronic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1034563846 7:151898357-151898379 CCCACAGAGCAGTGAGGTCTTGG - Intergenic
1037879184 8:22564915-22564937 GGCACAGTGAAGCCAGGCCTTGG + Intronic
1038679434 8:29653182-29653204 CACACAGAGATGGCAGGACTTGG - Intergenic
1039260953 8:35771247-35771269 CCCACAGTGAAGAGAGAGCTCGG + Intronic
1041782225 8:61589664-61589686 CCCACAGTGGAGGGAGACCTAGG + Intronic
1042686499 8:71447181-71447203 CCCAAAGAGGAGGAAGGTCTGGG - Intronic
1043935340 8:86136270-86136292 CACACTGTAGAGGCAGGTCTGGG + Intronic
1047571247 8:126100744-126100766 TACACAGTGAAGGCAAATCTGGG - Intergenic
1047892957 8:129333302-129333324 CACCCAATGAAGGCAGGACTTGG - Intergenic
1049238745 8:141525850-141525872 TCCAGAGTGATGGCAGGTCAGGG + Intergenic
1049646181 8:143736798-143736820 ACAACAGTGAAGGCGGGGCTGGG - Intergenic
1049778703 8:144417839-144417861 CCCACAGAGAGGGCAGGGCTGGG - Intergenic
1053316358 9:37055188-37055210 CCCCCAGTGCAGGCAGCCCTGGG - Intergenic
1053321350 9:37101556-37101578 CCCCCAGTGCAGGCAGCCCTGGG - Intergenic
1053386409 9:37694017-37694039 ACCTCACAGAAGGCAGGTCTAGG - Intronic
1053412185 9:37922988-37923010 GCCCCAGTGAAAGCAGGACTGGG - Intronic
1054804728 9:69386926-69386948 CCCACAGTGAAGGCAGGTCTTGG - Intronic
1056048463 9:82743569-82743591 CTCACAGTGAATGCAATTCTAGG + Intergenic
1056606914 9:88093434-88093456 CCCACAGGGAAGTCAGGGCAGGG - Intergenic
1056798564 9:89675614-89675636 CTCTCAGTGGAGGCAGGGCTTGG - Intergenic
1057610687 9:96540808-96540830 CCCTCAGTGTGGGCAGGTATGGG - Intronic
1060190096 9:121587192-121587214 CCCACAGGGAATGTAGATCTGGG + Intronic
1060839453 9:126782235-126782257 CACACAGTGAATGCAGGTGAGGG - Intergenic
1060864542 9:126985031-126985053 CCCACAGTGAAGGTATGACAAGG - Intronic
1061920812 9:133781406-133781428 CTCACAGTGCAGACAGCTCTGGG + Intronic
1203770658 EBV:48450-48472 CCCTCAGAGACGGCAGGTATAGG - Intergenic
1186213361 X:7273471-7273493 CCCACAGTCAAGGTAGGTTGGGG - Intronic
1189495305 X:41503239-41503261 CACACAGTAAAGGCAGGGCACGG - Intergenic
1192191580 X:68994447-68994469 TCCACACTCAGGGCAGGTCTGGG + Intergenic
1199741365 X:150739384-150739406 CCCTCAGCAAAGGCTGGTCTCGG + Intronic
1201901289 Y:19047651-19047673 CCCACAGTGGGTGGAGGTCTGGG - Intergenic