ID: 1054805707

View in Genome Browser
Species Human (GRCh38)
Location 9:69394138-69394160
Sequence TTAGATGGACACCAGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054805705_1054805707 -9 Left 1054805705 9:69394124-69394146 CCTGAGAGCATCAGTTAGATGGA No data
Right 1054805707 9:69394138-69394160 TTAGATGGACACCAGGAGCAAGG No data
1054805701_1054805707 26 Left 1054805701 9:69394089-69394111 CCAGCGACAACTGGAAGAGGAAA No data
Right 1054805707 9:69394138-69394160 TTAGATGGACACCAGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054805707 Original CRISPR TTAGATGGACACCAGGAGCA AGG Intergenic
No off target data available for this crispr