ID: 1054810286

View in Genome Browser
Species Human (GRCh38)
Location 9:69428802-69428824
Sequence CAGGTCCACCCAGCTGAAGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054810286_1054810290 7 Left 1054810286 9:69428802-69428824 CCCACTTCAGCTGGGTGGACCTG 0: 1
1: 0
2: 0
3: 26
4: 150
Right 1054810290 9:69428832-69428854 CTCCAGCAACTTCCACTCACTGG 0: 1
1: 0
2: 4
3: 25
4: 225
1054810286_1054810291 8 Left 1054810286 9:69428802-69428824 CCCACTTCAGCTGGGTGGACCTG 0: 1
1: 0
2: 0
3: 26
4: 150
Right 1054810291 9:69428833-69428855 TCCAGCAACTTCCACTCACTGGG 0: 1
1: 0
2: 1
3: 18
4: 261
1054810286_1054810294 25 Left 1054810286 9:69428802-69428824 CCCACTTCAGCTGGGTGGACCTG 0: 1
1: 0
2: 0
3: 26
4: 150
Right 1054810294 9:69428850-69428872 ACTGGGTGTGAAGACACACCTGG 0: 1
1: 0
2: 0
3: 11
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054810286 Original CRISPR CAGGTCCACCCAGCTGAAGT GGG (reversed) Exonic
901436509 1:9250227-9250249 CAAGTCCACCAAGCTCCAGTAGG - Intronic
903344075 1:22673358-22673380 CAGATCCCCCAAGATGAAGTTGG - Intergenic
904556620 1:31369076-31369098 CAGGGTCACCCAGCTGGAGCTGG + Intronic
904869939 1:33610522-33610544 CAGCTCCACCTCTCTGAAGTGGG - Intronic
906322021 1:44822938-44822960 CAGGTGCCACCAGCTGAAGGTGG - Intronic
906333765 1:44910251-44910273 CAGTTTCCCCCAGCTGAAATTGG - Intronic
906663085 1:47596387-47596409 CAGGCCCAGCCAGGTGAGGTGGG - Intergenic
908539048 1:65105228-65105250 CAGGACAAACCAGCTGAACTTGG + Intergenic
908678140 1:66629208-66629230 GAGGTTCAATCAGCTGAAGTTGG - Intronic
911164752 1:94714566-94714588 CTAGTTCACCCAGCTAAAGTTGG - Intergenic
912524643 1:110272165-110272187 CTGGTCCAACCAGCTGTAGCTGG - Intronic
912618748 1:111133877-111133899 CAGGGACACTCAGCTGAAGCTGG - Intronic
914326517 1:146622494-146622516 CAGGCCCCCAAAGCTGAAGTTGG - Intergenic
920277800 1:204820833-204820855 CAGGTCTACCCAGAGGAGGTGGG + Intergenic
921265675 1:213418872-213418894 CAGCTCCCCCCAGCTGCAGGTGG + Intergenic
923332206 1:232935497-232935519 AAGGTCCATCAAGCTGCAGTTGG - Intergenic
1063244663 10:4205724-4205746 CTTGCCCACCCAGCTGAAGAAGG + Intergenic
1063848204 10:10155453-10155475 GAGCTCCGCCCAGGTGAAGTGGG - Intergenic
1066314460 10:34230283-34230305 CTGGTCCACCCAGCAGCAGCAGG + Intronic
1067581768 10:47450857-47450879 CAGGACAAGCCAGCTGAAGTCGG + Intergenic
1068504552 10:57883207-57883229 CAGGTAGACCCAGTTTAAGTAGG - Intergenic
1069769606 10:70888785-70888807 CAGGGCCACCCAGCTGTAAGCGG - Intergenic
1069788254 10:71003583-71003605 CAGGGGTACCCAGGTGAAGTGGG + Intergenic
1074549254 10:114427662-114427684 CAGGCCCACCCTGCTGGAGGTGG - Intergenic
1076479200 10:130773535-130773557 CAGGTCTGCCCAGCAGAGGTCGG - Intergenic
1077322827 11:1949922-1949944 CCTGTCCACCCAGCTGAACGTGG + Intronic
1078517576 11:12036834-12036856 CAAATCCACCCTGCTCAAGTAGG + Intergenic
1080726854 11:34906632-34906654 GACGTCCTCACAGCTGAAGTAGG + Intronic
1083936760 11:65873384-65873406 AAGGACCACCCGGCTGAAGACGG - Intronic
1084531858 11:69732177-69732199 CAGGTAAACCCAGCTCAAGAGGG + Intergenic
1084680908 11:70665855-70665877 CAGGGTCACCCAGCTCAAGAAGG - Intronic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1089684624 11:120138852-120138874 CATGACCACCCAGCTGAAGAAGG - Intronic
1090331020 11:125932369-125932391 CAGGTCCACCCACCTCACATGGG + Intergenic
1091132370 11:133157323-133157345 CAGGTCCAGGCAGCTGCAGTCGG + Intronic
1202805845 11_KI270721v1_random:5235-5257 CCTGTCCACCCAGCTGAACGTGG + Intergenic
1101415069 12:104501736-104501758 CAGGTCCACCCACCAGATGCTGG + Intronic
1101514068 12:105418499-105418521 CAGCCCCACCCAGATGGAGTGGG + Intergenic
1102493097 12:113300690-113300712 CAGGTGGACCTGGCTGAAGTTGG - Intronic
1103651346 12:122435074-122435096 CAGTTTCAGCCAGGTGAAGTGGG + Intergenic
1104029125 12:125051604-125051626 CAGGTGATCCCAGCAGAAGTGGG + Intergenic
1104037429 12:125107321-125107343 CAGGGCCTCCCAGCTGATGATGG + Intronic
1104895249 12:132160808-132160830 CAGGTTCCCCCAGCTGGTGTCGG + Intergenic
1106393225 13:29355945-29355967 GATTTCCACCCAGCTGAACTAGG - Intronic
1107829889 13:44365108-44365130 CAGTTCCACCAAGATGAAGCTGG + Intergenic
1111511386 13:89268307-89268329 CAGGTACACCCTGCTGAAATGGG + Intergenic
1114596156 14:23913937-23913959 AAGGACCACCCACCAGAAGTGGG + Intergenic
1115751116 14:36490836-36490858 TATGTCCACAAAGCTGAAGTTGG - Intronic
1117403783 14:55381984-55382006 CTCCTCCACCCAGCTGTAGTAGG + Exonic
1119547009 14:75479321-75479343 GAGGTACACCCAGCTGGAGTGGG - Intergenic
1123757543 15:23408570-23408592 CAGCTACTCCCAGCTGAGGTGGG + Intergenic
1125779167 15:42248632-42248654 CATGTCCACCAAGATCAAGTTGG - Intronic
1128494408 15:68185532-68185554 CAGGAACACGCAGCTGAAGAAGG + Intronic
1129869202 15:78929919-78929941 CAGGGCCACACAGCTAAAGCTGG + Intronic
1132334723 15:101038903-101038925 AAGGTCCACCCAGATAATGTGGG + Intronic
1132885911 16:2181816-2181838 CAGGTCCTCCCAGGTGATGTCGG + Exonic
1136545065 16:30949931-30949953 AAGGGTCACCCAGCTGAAGGTGG + Intronic
1136990366 16:35148058-35148080 GAGCTCCACCAAGCTGAACTAGG + Intergenic
1137023326 16:35451568-35451590 CAGGTGCCCCCAGCTGAAGGTGG + Intergenic
1140007047 16:71088451-71088473 CAGGCCCCCAAAGCTGAAGTTGG + Exonic
1141138561 16:81482558-81482580 CATGTCCACCAGGCTCAAGTGGG - Intronic
1141878119 16:86840306-86840328 CTGGTCCTCCCAGCTGGACTGGG + Intergenic
1141892181 16:86933768-86933790 CAGCTCCACACAGCTGAGGATGG + Intergenic
1142762210 17:2049492-2049514 CAGGAACCCCTAGCTGAAGTGGG - Intergenic
1144711542 17:17404554-17404576 CAGTGCCACCCAGCTGAACCTGG - Intergenic
1145788650 17:27610488-27610510 CAGCCCCACCCAGCTGATCTGGG + Intronic
1145797799 17:27666094-27666116 CAGGCCCACCCAGCTGAGGATGG + Intergenic
1145812247 17:27771430-27771452 CAGGCCCACCCAGCGGAGGATGG + Intronic
1146842279 17:36164319-36164341 CAGGCCCACCCAGCTGAGGATGG + Intergenic
1146854589 17:36252278-36252300 CAGGCCCACCCAGCTGAGGATGG + Intronic
1146866031 17:36336098-36336120 CAGGCCCACCCAGCTGAGGATGG - Intronic
1146870489 17:36376170-36376192 CAGGCCCACCCAGCTGAGGATGG + Intronic
1146877847 17:36427251-36427273 CAGGCCCACCCAGCTGAGGATGG + Intronic
1147068900 17:37936710-37936732 CAGGCCCACCCAGCTGAGGATGG - Intergenic
1147073372 17:37976794-37976816 CAGGCCCACCCAGCTGAGGATGG + Intergenic
1147080424 17:38016247-38016269 CAGGCCCACCCAGCTGAGGATGG - Intronic
1147084894 17:38056332-38056354 CAGGCCCACCCAGCTGAGGATGG + Intronic
1147096371 17:38140207-38140229 CAGGCCCACCCAGCTGAGGATGG - Intergenic
1147100841 17:38180298-38180320 CAGGCCCACCCAGCTGAGGATGG + Intergenic
1147494814 17:40905530-40905552 CAGGAACGCCCGGCTGAAGTGGG + Intergenic
1147777776 17:42915233-42915255 CTGGTCCACGCAGCAGAAGTTGG - Intergenic
1148129691 17:45255408-45255430 CAGGTCCATCCTGCTGGAGGAGG + Exonic
1149845434 17:60006762-60006784 CAGGCCCACCCAGCTGAGGATGG + Intergenic
1150083782 17:62263345-62263367 CAGGCCCACCCAGCTGAGGATGG + Intergenic
1151476214 17:74345559-74345581 CAGCACCACCCAGCTGGTGTAGG + Intronic
1151657712 17:75503414-75503436 CAGCTCCTCCCAGGTGAGGTCGG + Exonic
1152303844 17:79510104-79510126 CCGGCCCACCCACCAGAAGTTGG + Intronic
1154351482 18:13587181-13587203 CAGGTCCACCCAGATCTACTGGG - Intronic
1157891970 18:51426547-51426569 CAGGTCCAACCAGCTTCAATGGG + Intergenic
1159955518 18:74515950-74515972 CAGGTCCACCTGGCAGAACTAGG - Intronic
1160277156 18:77447814-77447836 CAGGTCCAGGCAGCTGAGGGAGG + Intergenic
1160655984 19:270248-270270 GAGGTCCATCCAGGTGACGTGGG - Intergenic
1160656077 19:270862-270884 GAGGTCCATCCAGGTGACGTGGG - Intergenic
1161119430 19:2517287-2517309 CAGGTACTCCCAGCTGAGGCGGG - Intronic
1161343331 19:3754257-3754279 GGGGTCCACCCAGCTGGTGTCGG - Exonic
1161509799 19:4663923-4663945 CAGATCCCCCCGGCTGAAGGAGG - Intronic
1162495662 19:11022042-11022064 CAGGCCCAGCCAGCTGTAGCTGG - Intronic
1162662102 19:12177993-12178015 CAGCTACTCCCAGCTGAGGTGGG + Intronic
1164398227 19:27884802-27884824 GATGTCCTCACAGCTGAAGTAGG + Intergenic
1164940946 19:32251945-32251967 CAGGTCCCTCCTGCTGATGTCGG - Intergenic
1165195612 19:34100477-34100499 CAGGAACACCTAGCTGAAGAAGG + Intergenic
1166325269 19:42046107-42046129 CAAGGCCACCCAGCTGAAGCAGG + Intronic
1168625462 19:57914671-57914693 AAGGTCCAACCAGATGAAGCCGG + Intronic
925290903 2:2748168-2748190 CAGGCCCAACCAGCTGCAGCAGG - Intergenic
925809551 2:7685736-7685758 CAGTTCCCCCCAGTTGAAGATGG - Intergenic
925979696 2:9166830-9166852 CAGGCCTGCCCAGCTGCAGTTGG + Intergenic
932163255 2:69482026-69482048 CATGTACATCCAGCTGCAGTGGG - Intronic
936383671 2:112010313-112010335 CTGGGCCACCCAACTCAAGTTGG - Intronic
937310048 2:120896437-120896459 CAGGCCCACCAAGCTGGGGTGGG + Intronic
937896514 2:126980291-126980313 CACGGCCACCCAGCTAAAGATGG - Intergenic
1170643613 20:18177420-18177442 AAGGTCCACCCAGCTTCAGTGGG + Intronic
1172206145 20:33164246-33164268 CAGATCCTCCCTGCTAAAGTGGG - Intronic
1172588317 20:36100380-36100402 CAAAACCACCCACCTGAAGTGGG - Intronic
1176372271 21:6069178-6069200 CAGCTGCACCCAGGTCAAGTGGG + Intergenic
1179751247 21:43469361-43469383 CAGCTGCACCCAGGTCAAGTGGG - Intergenic
1181460840 22:23085086-23085108 CATGTCCACCTATCTGAGGTGGG - Intronic
1182461789 22:30488660-30488682 CAGGTCCTCCCGGCTCCAGTTGG + Intergenic
1182936826 22:34230992-34231014 CATATCCACCCAGCAGAAATGGG - Intergenic
1185079395 22:48701409-48701431 CGGGTCCACCCAGGTGCTGTGGG + Intronic
949473552 3:4420913-4420935 CAGGGTCACCCAGCTAATGTTGG - Intronic
951687578 3:25362224-25362246 CAGCTCTACCAAGCTGCAGTCGG + Intronic
954438599 3:50509288-50509310 CAGGTCCTCCCAGCTTCAATAGG + Intergenic
956217300 3:66861691-66861713 CAGGGCCACCTAGCTGGAGGTGG + Intergenic
957455756 3:80442132-80442154 CAGGCCCCCAAAGCTGAAGTTGG - Intergenic
962695170 3:137940700-137940722 CATGTCCAACCAGCTGAAATAGG - Intergenic
964529791 3:157655175-157655197 CAGGCACACCCAGCTGGTGTGGG - Intronic
968517913 4:1022611-1022633 GAGGTGCAGCCAGCTGAGGTGGG - Intronic
969094958 4:4725701-4725723 CAGGCCCACCCAGCAGATTTTGG - Intergenic
971396933 4:26237103-26237125 CAGGGCCAACCAGCTGCTGTTGG - Intronic
972151348 4:36094915-36094937 CAGGTCCACCTAGCTAGACTGGG + Intronic
979174982 4:117651908-117651930 GAGCTCCACCCAGCTGCACTGGG + Intergenic
979335144 4:119454337-119454359 CAGCTCCCCCCAGCTGAGGGGGG - Intergenic
985951276 5:3223095-3223117 CAGGCCCTCCCAGCTGAATGTGG - Intergenic
986203686 5:5602597-5602619 CAGGTCCAATCAGCTGCAGCTGG + Intergenic
990011061 5:50998671-50998693 CAGGTTCACTCAGCTGGATTAGG - Intergenic
991687320 5:69193503-69193525 TAGTCCCACCCAGCTGAGGTGGG + Intronic
998425916 5:142028566-142028588 GAGGTCCACCCACCTGCAGAAGG - Intergenic
999511675 5:152258838-152258860 CAGGGCCACCTAGCAGAACTGGG + Intergenic
1000339865 5:160268802-160268824 CAGGTCTACCCAGCGGACTTTGG - Intronic
1000409612 5:160924301-160924323 CAGGGGCACCCAGCTGAAGGTGG - Intergenic
1003297673 6:4847300-4847322 ATGGTCCACCCAGCTGTTGTAGG + Intronic
1003446893 6:6193075-6193097 CATGTCCTCCCTGCTGCAGTGGG - Intronic
1003567293 6:7231593-7231615 CAGGTCCACCCCGCCGCTGTTGG - Exonic
1003973085 6:11317622-11317644 CAAGTCAACCCAGCGGCAGTTGG - Intronic
1005425771 6:25701208-25701230 AAGGTCCACCCCGCTGATGCTGG - Exonic
1005463639 6:26091459-26091481 CTGGCCCACCAAGCTGGAGTGGG + Exonic
1007475456 6:42116779-42116801 CAGGTTCCCCCAGCTACAGTGGG - Intronic
1008142576 6:47848781-47848803 CAAGTCAACCCAGATGACGTTGG - Intergenic
1010452515 6:76018705-76018727 CGGGTCTACTCACCTGAAGTTGG + Exonic
1014934088 6:127365985-127366007 CAGGTTCCCCCAGCTTGAGTGGG + Intergenic
1020009112 7:4798888-4798910 CAGCCCCTCCCAGCTGAAGCAGG - Intronic
1020271179 7:6597148-6597170 CAGGGCCACGCTGCTGCAGTGGG + Intronic
1024996490 7:55276506-55276528 CAGGCCCACCCTGCTGTAGAAGG - Intergenic
1027368139 7:77479887-77479909 TGGGTCCACCCAGCCGGAGTAGG - Intergenic
1031358353 7:120816574-120816596 CAGATCCATCTAGCTGGAGTGGG + Intronic
1032269295 7:130388949-130388971 CAGGATCACCAAGCTGAAGAAGG - Intergenic
1040016294 8:42702949-42702971 CAGGGCCATCCAGCTGATGGTGG - Intronic
1046192105 8:110809714-110809736 CAGGACCACCCAGCTGCTGAGGG - Intergenic
1048826079 8:138428595-138428617 CAAGTTCACCCAGCTAATGTTGG + Intronic
1050381991 9:5041078-5041100 CAGGTCCTCCAGGCTGTAGTAGG - Intronic
1052359741 9:27541117-27541139 AAAGTTCACCCAGGTGAAGTGGG + Intergenic
1052932618 9:34068094-34068116 CTGGTCCAGTCAGCTGAGGTTGG + Intergenic
1054810286 9:69428802-69428824 CAGGTCCACCCAGCTGAAGTGGG - Exonic
1055286680 9:74736021-74736043 CAGGACCACACAGCTGAGGGCGG + Intronic
1056980864 9:91310017-91310039 CAGGTTGACCCAGGTGAACTTGG - Intronic
1057171158 9:92964014-92964036 AAAGTCCACCCAGCAGAAGCAGG + Intronic
1060697089 9:125718613-125718635 CAGGTTCTCCCAGGTGAAGAGGG - Intergenic
1060745255 9:126126962-126126984 AAGGACCCCCCAGCTGAAGCTGG - Intergenic
1060860756 9:126952888-126952910 CACGTCCACACTGCGGAAGTGGG + Intronic
1061357686 9:130118876-130118898 CAGGCACACCCAGCTGAGATGGG + Intronic
1061912331 9:133731750-133731772 CAGGCTCACTCAGGTGAAGTGGG + Intronic
1062669089 9:137695795-137695817 CAGGTCCACCCAGGCAAAGGAGG + Intronic
1191039479 X:56063887-56063909 CAGCTTCACCGAGCTGCAGTAGG + Intergenic
1192147798 X:68693632-68693654 CGAGTCCACTCAGCTCAAGTGGG - Intronic
1195202948 X:102567048-102567070 CAGGCCCAGAGAGCTGAAGTAGG + Intergenic
1195919439 X:109968057-109968079 CAGGGCCACCCAGATGATCTAGG - Intergenic
1196799671 X:119531320-119531342 AAGGACCACCCAGCAGAAGCAGG - Intergenic