ID: 1054810304

View in Genome Browser
Species Human (GRCh38)
Location 9:69429019-69429041
Sequence GGTTATGTATGTTCACCTAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054810304_1054810310 26 Left 1054810304 9:69429019-69429041 CCTTTAGGTGAACATACATAACC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1054810310 9:69429068-69429090 ACTACTGGAGTTCTGTCCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 127
1054810304_1054810308 -1 Left 1054810304 9:69429019-69429041 CCTTTAGGTGAACATACATAACC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG 0: 1
1: 0
2: 0
3: 0
4: 61
1054810304_1054810309 11 Left 1054810304 9:69429019-69429041 CCTTTAGGTGAACATACATAACC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1054810309 9:69429053-69429075 GTTGTACAGGGATGCACTACTGG 0: 1
1: 0
2: 0
3: 3
4: 45
1054810304_1054810307 -2 Left 1054810304 9:69429019-69429041 CCTTTAGGTGAACATACATAACC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG 0: 1
1: 0
2: 0
3: 3
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054810304 Original CRISPR GGTTATGTATGTTCACCTAA AGG (reversed) Exonic
906339886 1:44970153-44970175 AGTTATGTTTTTTCACTTAAAGG - Intronic
909519886 1:76555526-76555548 GGTCATTAATGTTCTCCTAAAGG + Intronic
910639672 1:89446352-89446374 GACTATCTATGTTCACTTAAGGG + Intergenic
916417259 1:164603494-164603516 GGATCTGTATTTTCACATAATGG - Intronic
917683200 1:177388807-177388829 GGATATGTATGTTCTTCTGATGG + Intergenic
922417610 1:225435913-225435935 TGTCATATATGTTCTCCTAAAGG + Intergenic
923116682 1:230946954-230946976 GTTTATTTCTGTGCACCTAATGG - Intronic
1062775355 10:140760-140782 GCTTAAGTATGTGCACGTAAGGG - Intronic
1073643547 10:105276775-105276797 CTTTATTTATGTTCATCTAATGG + Intergenic
1076312789 10:129520610-129520632 GGTTCTGTAGGTGCACCTTAGGG - Intronic
1076562508 10:131376502-131376524 GCTTATGTATGTTCTCTTCATGG + Intergenic
1092596050 12:10005689-10005711 GGTCAGGTATATTCACCTGATGG + Intronic
1096879678 12:54657717-54657739 GGTTAAGTGTGTTAATCTAAAGG + Intergenic
1098573082 12:72011122-72011144 AGTTATGTAAGTTCAGCAAAGGG + Intronic
1098688652 12:73458291-73458313 GGTTATTTCTGTGCACCTTACGG + Intergenic
1099205478 12:79721593-79721615 GATTATGTTTGTTGACCTTAAGG - Intergenic
1100136907 12:91564314-91564336 GGTTGTGTAAGTTAACATAAGGG + Intergenic
1105410726 13:20169148-20169170 GGCTTTGTATGTCCACCAAAAGG + Intergenic
1108252890 13:48584346-48584368 GGTTATGTACCGTCACTTAATGG + Intergenic
1113278211 13:108758609-108758631 GGTCATGTCTGTTCTTCTAATGG - Intronic
1115075995 14:29391022-29391044 TGTTATATATGTTTTCCTAACGG - Intergenic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1123675489 15:22707241-22707263 ATTTGTGTATGTTCACTTAAGGG + Intergenic
1128361181 15:66962829-66962851 GATATTGCATGTTCACCTAATGG + Intergenic
1134407210 16:13971006-13971028 GTTTATGTATGTTCAACTTCAGG + Intergenic
1137021924 16:35436566-35436588 GTTTATGTATGTTCATCTTTAGG - Intergenic
1137991201 16:53157650-53157672 AAATATGTATGTTCACTTAATGG - Intronic
1139110798 16:63888191-63888213 GGTTATGTATGATAACCTATTGG + Intergenic
1139146262 16:64328985-64329007 GGTTATGTCCATTGACCTAAGGG - Intergenic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1149024331 17:52008491-52008513 GGTTAAGTATGTTAATTTAATGG + Intronic
1153801423 18:8674028-8674050 TGTTATTTATGTTGACATAATGG - Intergenic
1155947448 18:31871754-31871776 GGTTTTGTATATTCACATAATGG - Intronic
926548474 2:14271525-14271547 GGTTATTTTTGATCACCTGATGG - Intergenic
930178549 2:48326382-48326404 GGTTAAGGATTTTGACCTAAGGG + Intronic
936157304 2:110056704-110056726 GTTTATGTATGTGCACATCAAGG + Intergenic
936187390 2:110314740-110314762 GTTTATGTATGTGCACATCAAGG - Intergenic
937472260 2:122184274-122184296 GTTTATTTAAGGTCACCTAATGG - Intergenic
942504981 2:176632403-176632425 GGTTCTGTATGGGCACCTACCGG - Intergenic
945600269 2:211853910-211853932 GGTTATGTGTGTTCAGAAAAGGG + Intronic
945712734 2:213319567-213319589 GATTTTGTATATTCATCTAATGG + Intronic
947038169 2:225884060-225884082 GTTTATGTAAGTTCACTTGATGG + Intergenic
1170548978 20:17459393-17459415 GTATCTGTATGTTCACCAAAAGG - Intronic
1183400672 22:37602082-37602104 GCTTATGTAGATTCACCTCAAGG - Intergenic
957379652 3:79410216-79410238 TGGTATGTATTTTCACGTAATGG + Intronic
962631899 3:137285256-137285278 TGTTATTTATTTTCACTTAAAGG - Intergenic
963583143 3:147152222-147152244 GGTTTTCGATGTTCACCTACAGG + Intergenic
964584626 3:158283535-158283557 AGTTATGTATTTTCACGAAATGG - Intronic
972109470 4:35539633-35539655 GCTTATATATGTTTACCCAAGGG + Intergenic
972149318 4:36068812-36068834 TTTTATGTATGTTCACCTTATGG + Intronic
976564341 4:86536575-86536597 GATTATGTATCTACAACTAAAGG - Intronic
977007136 4:91582011-91582033 GTTTATGTATATGCACCTCAAGG + Intronic
980247496 4:130266729-130266751 GGTCATGTATGTTCACAAAGAGG + Intergenic
980900201 4:138897652-138897674 TGTTATTTAACTTCACCTAATGG + Intergenic
983779046 4:171644970-171644992 AGTTTTGTTTTTTCACCTAAGGG - Intergenic
985811943 5:2096773-2096795 GGTTTTGGATGTTTACCTGAAGG - Intergenic
988026010 5:25690831-25690853 GATTATGCATGTTCAGCTGATGG - Intergenic
989815077 5:45726244-45726266 AGTTATATATACTCACCTAATGG - Intergenic
994144514 5:96378861-96378883 GTATATGTATTTTTACCTAATGG + Intergenic
998438200 5:142132097-142132119 TGTTATGTATGTACTCTTAAGGG + Intronic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
1000924917 5:167181532-167181554 TGTTATATGTGTTGACCTAAAGG - Intergenic
1011096400 6:83669854-83669876 ATTTTTGTATGTTCATCTAATGG - Intronic
1011616100 6:89199645-89199667 GGTTATATATGCTCATCTGAAGG + Intronic
1014633049 6:123811066-123811088 GAATATGTGTCTTCACCTAATGG + Intronic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1039254925 8:35708662-35708684 GGTTTGGTAAGTTCACCTGAAGG + Intronic
1040659929 8:49559787-49559809 GGTAATTAATGTTCACCAAAAGG + Intergenic
1045413170 8:101940355-101940377 TGTTATATATGTCCACATAAGGG - Intronic
1047009983 8:120661871-120661893 GTTTATGTATGTTCAGAGAATGG + Intronic
1049126899 8:140798310-140798332 GGCAATGTATCTTCACCTTAGGG + Intronic
1052214921 9:25954348-25954370 GGTTATGCATATGCACCCAAAGG + Intergenic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1188376474 X:29435968-29435990 AGTTATGTTTTTTCCCCTAATGG - Intronic
1188694481 X:33173361-33173383 GTTTATGTATTTTCATCAAAAGG + Intronic
1194845742 X:98806715-98806737 GATTATGTATGTGCACCAAGGGG - Intergenic
1199579951 X:149351125-149351147 GGCTCTGTATATTCACCCAAGGG - Intergenic