ID: 1054810307

View in Genome Browser
Species Human (GRCh38)
Location 9:69429040-69429062
Sequence CCGTTATGTGCAGGTTGTAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 46}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054810304_1054810307 -2 Left 1054810304 9:69429019-69429041 CCTTTAGGTGAACATACATAACC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG 0: 1
1: 0
2: 0
3: 3
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054810307 Original CRISPR CCGTTATGTGCAGGTTGTAC AGG Exonic
904192912 1:28761476-28761498 CCGTTATGTGCTGGGATTACAGG - Intronic
906217668 1:44053277-44053299 CCCTTATGTGCAGGCTTTTCTGG + Intergenic
906812018 1:48836862-48836884 CTTTTATGTGCTGGTTGTAGAGG + Intronic
907240256 1:53077325-53077347 CCTTGAGGTGCAGCTTGTACAGG - Exonic
907485841 1:54777531-54777553 CCGTGATGAGCAAGTTATACTGG - Intergenic
917612078 1:176699161-176699183 CCGTCATGTTCATGTGGTACAGG - Exonic
1067139140 10:43641443-43641465 CAGTCATGTGAAGGTTCTACTGG + Intergenic
1067211913 10:44266521-44266543 ACGTTAAGTGCAGGTGGAACAGG - Intergenic
1079744931 11:24113889-24113911 CCCTCATGTGAAGGTGGTACGGG + Intergenic
1085744476 11:79103021-79103043 CCCTCATCTGGAGGTTGTACTGG - Intronic
1088150751 11:106742205-106742227 CTTTTATGTGCAGGATGTGCAGG + Intronic
1088715493 11:112545574-112545596 CAGTCATGTTCAGGTTGTACAGG - Intergenic
1089806424 11:121094591-121094613 CCATTATTAGCAGGTTGAACAGG + Intergenic
1101045743 12:100803977-100803999 CGGTAATGTGCAGGATGTGCAGG + Intronic
1104655721 12:130572520-130572542 CCCCTGTGTGCAGGTTTTACTGG + Intronic
1105539178 13:21299672-21299694 ACAATATGGGCAGGTTGTACTGG + Intergenic
1105799064 13:23887952-23887974 GCAATATGGGCAGGTTGTACTGG - Intronic
1128674429 15:69598145-69598167 CCCTTATGAGGAGGTTGTAGTGG + Intergenic
1133011220 16:2912755-2912777 CCGTTATGTGCAGGCTCCATGGG - Intronic
1146365430 17:32221586-32221608 CCTTTAAATGCAGGTGGTACAGG + Intronic
1149978912 17:61293732-61293754 CCATTATGTGCAGGATCTACTGG + Intronic
1152571600 17:81123550-81123572 CCTTTATGTGCAGGCTCCACAGG - Intronic
1153156894 18:2159909-2159931 CCTTTATGTGGAGCTTTTACTGG + Intergenic
1157065657 18:44347282-44347304 CAGTTCTGTGCAGGATGTGCAGG + Intergenic
1158289085 18:55918574-55918596 CCGCAATGTGCAGCGTGTACCGG - Intergenic
1160582921 18:79897936-79897958 GCGATATGAGCAGGTTGTAAAGG - Intronic
1162367517 19:10258409-10258431 CCATGATGTGCAGGTCGTCCTGG - Exonic
1163400339 19:17088319-17088341 CAGTTAAGATCAGGTTGTACTGG - Intronic
926104831 2:10143572-10143594 CGGTAACGTGCAGGTTGCACTGG + Intronic
1174634917 20:51990703-51990725 CAGTTATATTCAGGTTTTACAGG - Intergenic
1176411147 21:6450259-6450281 CCTTTGTGTGCAGGCTGTCCTGG - Intergenic
1179686640 21:43058581-43058603 CCTTTGTGTGCAGGCTGTCCTGG - Intronic
1181130694 22:20729976-20729998 CAGTTATGTCCAGGTTGCTCCGG + Exonic
1182532489 22:30970583-30970605 CTGTTATCTGCTGCTTGTACTGG + Intergenic
953272321 3:41457705-41457727 CCTTTGTGTGCATCTTGTACAGG + Intronic
955118991 3:56036751-56036773 TCCTGATTTGCAGGTTGTACAGG - Intronic
965905365 3:173699045-173699067 GCGTTATCTCCAGGTTGTTCAGG + Intronic
967197532 3:187041595-187041617 CAGTTCTGTGCATGTTGTACTGG + Intronic
968286065 3:197509616-197509638 CCGGCCTGTGCAGGTTGTTCTGG - Intergenic
975660051 4:76679740-76679762 TGGTTATGTGCAGGATGGACAGG - Intronic
993360903 5:86975130-86975152 CAGATGTGTGGAGGTTGTACTGG + Intergenic
1015358854 6:132313127-132313149 CCTATATGTGCATGTTGTATGGG + Intronic
1017006355 6:150030364-150030386 CTGTCATTTGCAGGTTGTCCTGG - Intergenic
1017595556 6:156025168-156025190 CCGTTATTTCCAAGCTGTACTGG - Intergenic
1029939744 7:104467488-104467510 TTGTGAAGTGCAGGTTGTACAGG + Intronic
1034643726 7:152625819-152625841 CAGGGATGTGCAGGCTGTACAGG + Intergenic
1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG + Exonic
1199993384 X:153003004-153003026 CAGTGTTCTGCAGGTTGTACAGG + Intergenic
1202141706 Y:21731193-21731215 CAGTCATGTTCAGGTTGTTCAGG - Intergenic
1202145159 Y:21772609-21772631 CAGTCATGTTCAGGTTGTTCAGG + Intergenic