ID: 1054810308

View in Genome Browser
Species Human (GRCh38)
Location 9:69429041-69429063
Sequence CGTTATGTGCAGGTTGTACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 61}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054810304_1054810308 -1 Left 1054810304 9:69429019-69429041 CCTTTAGGTGAACATACATAACC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG 0: 1
1: 0
2: 0
3: 0
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054810308 Original CRISPR CGTTATGTGCAGGTTGTACA GGG Exonic
900920503 1:5667441-5667463 CACTGTGTGCAGGTTGCACAAGG - Intergenic
902875704 1:19339635-19339657 CGTTATCAGCAGATTGAACAGGG + Intronic
907240255 1:53077324-53077346 CTTGAGGTGCAGCTTGTACAGGG - Exonic
912881555 1:113421634-113421656 TGTTATGTGAAGCTTGTACCAGG + Intronic
919040232 1:192377867-192377889 TGTTATGTGTAGCTTGTAGAGGG - Intergenic
922680889 1:227594659-227594681 CTTTATGTGCAAGATGTATAAGG - Intronic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1081105111 11:39057810-39057832 CTTTATGTGCAGGTAGAAGAGGG - Intergenic
1086750889 11:90491841-90491863 CTTTATGAGCAGGTTGAAAATGG + Intergenic
1092011278 12:5114676-5114698 CATTACGTGCAGGTTAAACACGG + Intergenic
1105539179 13:21299673-21299695 CAATATGGGCAGGTTGTACTGGG + Intergenic
1105799063 13:23887951-23887973 CAATATGGGCAGGTTGTACTGGG - Intronic
1108770062 13:53688787-53688809 AGGTATGTACAGGTCGTACAGGG + Intergenic
1115243011 14:31267895-31267917 CCTTATGTGTGGGTTGCACATGG - Intergenic
1115347468 14:32358658-32358680 GGATACGTGCAGGTTGTAGATGG + Intronic
1120794213 14:88614180-88614202 TTTTATGGGCAGGTTGTTCAGGG + Exonic
1125000280 15:34762757-34762779 CGTTATGTTTAGGCTGGACACGG + Intergenic
1127862321 15:63004513-63004535 AGTGATGAGCAGGTTGTGCATGG + Intergenic
1130082959 15:80750652-80750674 AGTTTTGTGCAGTTTGTACCAGG + Intronic
1132081784 15:98872129-98872151 CATTTAGTGCAGGTTGGACATGG - Intronic
1132984921 16:2760404-2760426 CGTTGTGTGCTGGTAGTACCTGG - Exonic
1155514271 18:26608417-26608439 TGTTATGTGCCAGTTGGACATGG + Intronic
1155753040 18:29453284-29453306 CTTTATGTGTAGGCTGCACATGG + Intergenic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925681239 2:6423675-6423697 CGTTACGTGCAGGGCCTACAAGG + Intergenic
927099390 2:19776332-19776354 CCTAATGTGCAGCTTGTACTTGG - Intergenic
931448586 2:62348235-62348257 CTTTATGTCCAGTTTTTACATGG - Intergenic
935119364 2:100168888-100168910 CGATATGTGAAGGTAGTATAAGG - Intergenic
946430625 2:219625384-219625406 CTTGGTGTGCAGGATGTACATGG + Intergenic
1171816201 20:29787856-29787878 CACTGTGTGCAGGTTGCACAAGG + Intergenic
1171902163 20:30868184-30868206 CACTGTGTGCAGGTTGCACAAGG - Intergenic
1172853003 20:37980078-37980100 CGTGATCTGCAGGCTGTAGAAGG - Intergenic
1180335537 22:11574119-11574141 CACTGTGTGCAGGTTGCACAAGG - Intergenic
951452796 3:22858372-22858394 TTTGATGTGCAGGTTGTAGATGG - Intergenic
953272322 3:41457706-41457728 CTTTGTGTGCATCTTGTACAGGG + Intronic
959116467 3:102184290-102184312 CACTAGGTGCAGGTTTTACATGG + Intronic
974887635 4:67840072-67840094 TGTTAAGTCTAGGTTGTACAGGG + Intronic
983708271 4:170685099-170685121 GTTTATGTGCAAGGTGTACAAGG + Intergenic
984840773 4:184065362-184065384 CGGTATGAGCACCTTGTACAGGG + Intergenic
987930645 5:24396110-24396132 AGTTATGTGCAAGGTGTATAAGG - Intergenic
991305965 5:65176359-65176381 GTTTATGTGCAAGTTGTATAAGG + Intronic
996615483 5:125436216-125436238 CATTATCTGCTGGGTGTACAGGG - Intergenic
1002221307 5:177684759-177684781 CTTTAAGTGTAGGTTGTACTTGG + Intergenic
1003469817 6:6418885-6418907 CTTTAAGTGCAGGCTGCACACGG - Intergenic
1004437782 6:15613818-15613840 GGTTGTGTGCAGGCTGTAAATGG - Intronic
1008123374 6:47642918-47642940 GTTTATGTGCAGGGTGTATAAGG + Intergenic
1011668752 6:89661763-89661785 CTTTCTGTGCAGGTTATCCAAGG + Intronic
1011732773 6:90282897-90282919 AGTTATTTGCAGGTTGAACTTGG + Intronic
1017410381 6:154161738-154161760 CGTTAGGTGCAGGGAATACAGGG - Intronic
1022490090 7:30810358-30810380 GTTTATGTGCAAGGTGTACAAGG + Intronic
1028966066 7:96802623-96802645 CTTTATGCGCAAGTTGTACCAGG + Intergenic
1031971675 7:128069076-128069098 GGATCTGTGCAGGTGGTACAGGG + Intronic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1203367876 Un_KI270442v1:274141-274163 CACTGTGTGCAGGTTGCACAAGG + Intergenic
1189717027 X:43877513-43877535 CGTTATCTACATGCTGTACAAGG - Intronic
1190487841 X:50946446-50946468 CATTATGTGCAGTTTTTCCATGG + Intergenic
1190540919 X:51477829-51477851 CTTTATGTGCAAGGTGTATAAGG - Intergenic
1194280289 X:91943612-91943634 CGTTAGCTGTAGGTTTTACATGG - Intronic
1195201789 X:102558193-102558215 CTTTATGTACAGCTTGCACAGGG + Intergenic
1198769279 X:140111670-140111692 AAATATGTGCAGGTTGTAGATGG + Intergenic
1200597766 Y:5167106-5167128 CGTTAGCTGTAGGTTTTACATGG - Intronic
1201462607 Y:14243381-14243403 AGTCATGTGCAGGTTTTAAAAGG - Intergenic