ID: 1054810309

View in Genome Browser
Species Human (GRCh38)
Location 9:69429053-69429075
Sequence GTTGTACAGGGATGCACTAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 45}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054810306_1054810309 -10 Left 1054810306 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1054810309 9:69429053-69429075 GTTGTACAGGGATGCACTACTGG 0: 1
1: 0
2: 0
3: 3
4: 45
1054810304_1054810309 11 Left 1054810304 9:69429019-69429041 CCTTTAGGTGAACATACATAACC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1054810309 9:69429053-69429075 GTTGTACAGGGATGCACTACTGG 0: 1
1: 0
2: 0
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054810309 Original CRISPR GTTGTACAGGGATGCACTAC TGG Exonic
901449659 1:9328293-9328315 GTTGTGCAAAGATGCACTCCAGG + Intronic
904781823 1:32955610-32955632 GGACTACAGGCATGCACTACAGG - Intronic
910591210 1:88929405-88929427 GATGTACAGGGATGCACAAAAGG - Intergenic
912585519 1:110761222-110761244 GTTGGACAGGGCAGCACTTCAGG + Intergenic
919084999 1:192911012-192911034 GTTGGACAGGGATTCTCTCCTGG - Intergenic
1067283442 10:44890420-44890442 GTTGAACTGGGAAGCACTAGAGG + Intergenic
1068859715 10:61835002-61835024 GTAGAACAGGCATGCAATACAGG + Intergenic
1070343869 10:75523024-75523046 ATTGTCCAAGGCTGCACTACTGG - Intronic
1072723933 10:97800079-97800101 GTTGTCCAGGGGTTCACAACAGG - Intergenic
1093786657 12:23199596-23199618 GTGGTACTGGGATTCAGTACTGG + Intergenic
1104208859 12:126667581-126667603 GGTGAACAGTGATGCAATACTGG + Intergenic
1104469664 12:129019287-129019309 GTTGGCCAGGGCTGCACTATTGG - Intergenic
1105713610 13:23038388-23038410 GTTGTAGAAGAAAGCACTACAGG + Intergenic
1130262327 15:82365808-82365830 CTTTTACAGGAATGCACTGCAGG - Intergenic
1130278901 15:82503199-82503221 CTTTTACAGGAATGCACTGCAGG + Intergenic
1130438212 15:83924220-83924242 GTTGCACAGGAATGCTCTTCAGG + Intronic
1130623237 15:85486056-85486078 CTTTTACAGGAATGCACTGCAGG - Intronic
1130843547 15:87723826-87723848 GTTGTATAGGGCTGGACTCCAGG - Intergenic
1137003850 16:35254520-35254542 GTTGTACAGTGATGAAGTATGGG - Intergenic
1144487307 17:15677602-15677624 CTTGTACAGGGATGTAATGCTGG - Intronic
1144913726 17:18704716-18704738 CTTGTACAGGGATGTAATGCTGG + Intronic
1157159740 18:45302712-45302734 GGTGTACAGCAATGCACTATGGG + Intronic
928813617 2:35260566-35260588 GTTGAACTGGGATAAACTACTGG + Intergenic
935628290 2:105189798-105189820 GATGTACAGCAATGCACTTCTGG + Intergenic
936953067 2:117997754-117997776 GTTTTACTGGGATGGAGTACAGG - Intronic
943098553 2:183458561-183458583 ATTTTACAGGCATGCACTACAGG + Intergenic
1177243174 21:18488303-18488325 ATTATACAGGGATGCATTTCTGG + Intergenic
949217457 3:1586903-1586925 GTTCTACAGGGCTGCAATAACGG + Intergenic
958604701 3:96341836-96341858 GTTGATTAGGGATGCACCACTGG - Intergenic
959028834 3:101273631-101273653 GCAGTACAGGGAAGAACTACAGG - Exonic
966353677 3:179057350-179057372 GATGTACAGGGATGCAAAAAAGG - Intronic
969044769 4:4328646-4328668 GGAGTACAGTGATGCACTCCTGG + Intergenic
970420563 4:15902046-15902068 GTTGTTCAGGGATGGGCTCCAGG - Intergenic
971927472 4:33031594-33031616 TTTGAACTGGGATTCACTACAGG - Intergenic
974906224 4:68060690-68060712 GTTTTACAGGGCTGCATTAAAGG - Intronic
992479952 5:77140671-77140693 TATGTACAGGGATGGACTAGTGG + Intergenic
1005881563 6:30066296-30066318 GTTGTAGATGTGTGCACTACAGG - Intergenic
1011505595 6:88039360-88039382 GTTTAACAGGGATGCAAAACTGG + Intergenic
1014072880 6:117203819-117203841 GATGCACAGGGATGGACTCCGGG + Intergenic
1025170958 7:56756164-56756186 GGACTACAGGCATGCACTACCGG + Intergenic
1025700922 7:63819534-63819556 GGACTACAGGCATGCACTACCGG - Intergenic
1027984686 7:85272327-85272349 ATTGCTCAGGGATGCCCTACGGG - Intergenic
1030762624 7:113370078-113370100 AATCTACAGGGATGGACTACAGG + Intergenic
1032274049 7:130439379-130439401 GTTGTACATGGATTTTCTACTGG + Intronic
1034054814 7:148022918-148022940 GTGTCACAGGGATGCACTTCAGG - Intronic
1037710097 8:21348579-21348601 GTTGTTCAGGGATGTACTGGGGG + Intergenic
1039745809 8:40425467-40425489 GTTGTTCAGGGAGTCACTACTGG + Intergenic
1054810309 9:69429053-69429075 GTTGTACAGGGATGCACTACTGG + Exonic
1189463968 X:41264284-41264306 GAATTACAGGGATGCACCACAGG - Intergenic