ID: 1054810310

View in Genome Browser
Species Human (GRCh38)
Location 9:69429068-69429090
Sequence ACTACTGGAGTTCTGTCCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054810304_1054810310 26 Left 1054810304 9:69429019-69429041 CCTTTAGGTGAACATACATAACC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1054810310 9:69429068-69429090 ACTACTGGAGTTCTGTCCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 127
1054810306_1054810310 5 Left 1054810306 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1054810310 9:69429068-69429090 ACTACTGGAGTTCTGTCCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054810310 Original CRISPR ACTACTGGAGTTCTGTCCCC TGG Exonic
900875898 1:5342187-5342209 ACTTCTGGAATTCTGAGCCCTGG + Intergenic
903874381 1:26463192-26463214 ACTGCAGGAGTTCTGTCTCTTGG - Intronic
908321017 1:62978959-62978981 ACTACATTAGTTCTGTTCCCAGG - Intergenic
910195105 1:84632365-84632387 ACTGCTGGTGGTCTCTCCCCAGG + Intronic
910902816 1:92140536-92140558 ACTACTAAGGTTTTGTCCCCTGG + Intronic
912450528 1:109765113-109765135 AGTCCTGGGGTTCTTTCCCCTGG + Intronic
915935850 1:160089887-160089909 AAGACTGGAGTGCTTTCCCCAGG - Exonic
920763371 1:208807535-208807557 CCTACTGAAATTCTGTGCCCTGG + Intergenic
922465516 1:225843619-225843641 ACTCCTGCAGCTCTGGCCCCGGG + Intronic
922988448 1:229884995-229885017 AGACCTGGAGTTCTGTCTCCTGG - Intergenic
923196483 1:231673242-231673264 ATTACTGGTGTGCTGTCCCCTGG + Intronic
924691473 1:246355729-246355751 TCTAATGGAGTTATGTTCCCAGG - Intronic
1063002381 10:1936401-1936423 ACTGCTGGAGTTCTGCCCTGGGG - Intergenic
1068206312 10:53859213-53859235 AGTACTGGAGTCCTGGCCTCAGG + Intronic
1071932144 10:90484615-90484637 ACCAATGGAGTTATGTTCCCAGG + Intergenic
1073702201 10:105940115-105940137 ACAACAGGAGTTCAGTCTCCTGG - Intergenic
1077071700 11:676978-677000 GCTCCTGGATCTCTGTCCCCAGG - Intronic
1083147197 11:60768325-60768347 CCTCCAGGAGCTCTGTCCCCTGG + Intronic
1088387493 11:109275692-109275714 ACCAATGGAGTTATGTTCCCTGG + Intergenic
1088847928 11:113683178-113683200 ACTTCTGTAGATCTGTCCCAGGG + Intergenic
1093814951 12:23534475-23534497 ACTGCTGGTGTTGTGTACCCTGG - Exonic
1096772213 12:53942740-53942762 AAGACTGGAGTTATTTCCCCAGG + Intronic
1102538030 12:113596245-113596267 ATTTCTGGAGTTATCTCCCCAGG - Intergenic
1113427459 13:110220892-110220914 TATACTGGACTTCTGGCCCCAGG + Intronic
1114086453 14:19239504-19239526 CCTACTGAATATCTGTCCCCAGG + Intergenic
1114268610 14:21087985-21088007 TCTTCTGGAGATGTGTCCCCAGG + Exonic
1117395858 14:55309823-55309845 ACCACTGGAGTTCTGTCCTTTGG + Intronic
1117780051 14:59222921-59222943 ACTGCTGAAGTTCTGCCCACTGG + Intronic
1118162315 14:63302358-63302380 GCCACTGGAGTTGTGTACCCAGG - Intergenic
1121956172 14:98215454-98215476 ACCTCTGGACTTCTGTCCCGAGG + Intergenic
1122436948 14:101706868-101706890 ACTTCTGGAGTCCTGTCCCAGGG - Intergenic
1124665301 15:31586988-31587010 ACTCCTGGAGTTTTGTCCTCAGG + Intronic
1126190245 15:45871403-45871425 GCCAATGGAGTTCTGTTCCCTGG - Intergenic
1127361184 15:58246455-58246477 CCTGCTGGAGTTTTGTACCCAGG + Intronic
1128214131 15:65922666-65922688 CCCTCTGCAGTTCTGTCCCCAGG - Intronic
1129672876 15:77616767-77616789 ACTCCTGCAGTTCTTTCCTCTGG + Intronic
1131429291 15:92373658-92373680 ACTGATTGAGTTCTGGCCCCAGG + Intergenic
1135114418 16:19713002-19713024 AAAACTGGAGTTCTGTTACCAGG - Intronic
1136450626 16:30352564-30352586 ACTTCTGGGGCTCTGTCCTCTGG + Exonic
1136605685 16:31331686-31331708 GCTACTGGGGTTCGGCCCCCGGG - Exonic
1138181016 16:54940076-54940098 ACAACTGGGGTTCAGTCTCCAGG + Intergenic
1139247114 16:65455833-65455855 ATTACTGGAGTTCTGTCAGAAGG - Intergenic
1142940460 17:3376497-3376519 ACCACTGGAGTTATGTTCCCAGG + Intergenic
1143964903 17:10750169-10750191 ACTACTTGAGTTCTTTTCCTGGG + Intergenic
1144225715 17:13143350-13143372 AGTTCTGGAGTTCTGTTGCCTGG + Intergenic
1146553105 17:33799024-33799046 ACTTCTGGATTTCTGTCCAGAGG + Intronic
1148865994 17:50628943-50628965 ATTCCTAGAGTTCTGTCACCTGG + Intergenic
1150836554 17:68569189-68569211 ACTCCTGGAATTCTGACTCCAGG - Intronic
1153409864 18:4781629-4781651 TCTCCTGGACTTCTTTCCCCAGG - Intergenic
1162027253 19:7901325-7901347 ACTTCTGGAGTTCTCTCCCAAGG + Exonic
1163389885 19:17024281-17024303 ATTACCAGAGTTCAGTCCCCTGG + Intronic
1165130022 19:33626077-33626099 GCTAATGCAGCTCTGTCCCCGGG - Intronic
1165601182 19:37056807-37056829 ACTCCCGGAGTCCTGTCCTCAGG - Intronic
1166081499 19:40446475-40446497 ACTAGTGTAACTCTGTCCCCGGG + Intergenic
1168719295 19:58546020-58546042 GCTTCTGGAGTTCTGCCCTCGGG - Intronic
926424057 2:12725403-12725425 ACCTCTGGAGTTCTGCCTCCTGG - Intronic
927643451 2:24860297-24860319 ACAACTCCAGTTCTGTCCTCTGG + Intronic
927773058 2:25880301-25880323 ATTTCTGGAGCTCTATCCCCAGG + Intergenic
928441817 2:31298389-31298411 CCTCCAGGAGTTCTTTCCCCTGG + Intergenic
929412417 2:41711942-41711964 AGTCCTGCAATTCTGTCCCCTGG + Intergenic
930743912 2:54861382-54861404 ACTTCAGGAGTTATCTCCCCAGG + Intronic
932397898 2:71460702-71460724 ACTGCTGGTGATCTGACCCCTGG - Intronic
938900143 2:135792673-135792695 GCCAGTGGAGTTCTGTTCCCAGG - Intronic
941461590 2:165778734-165778756 AGTTCTAGGGTTCTGTCCCCCGG - Intronic
946165575 2:217861788-217861810 ACTACTCGTGTTCTGTCCTTTGG - Intronic
948405574 2:237715886-237715908 ACTAGGGGCGTTCTCTCCCCAGG + Intronic
1171378640 20:24714856-24714878 ACCAATGGAGTTATGTTCCCAGG + Intergenic
1172260460 20:33559866-33559888 ACTTCTGGAGTTATGTCCCAAGG - Intronic
1172837703 20:37883568-37883590 ACACCTGGAGGTCTGTCCCCAGG + Intergenic
1174056046 20:47799263-47799285 ACAGCTGGAGTTCAGTCCCATGG + Intergenic
1174098842 20:48111036-48111058 ACTACTGTATTTCTGGCACCGGG + Intergenic
1175476092 20:59275598-59275620 GCCACTTGAGGTCTGTCCCCAGG + Intergenic
1175796088 20:61771898-61771920 ACAGCTGGAAATCTGTCCCCAGG - Intronic
1175916407 20:62428057-62428079 GCTGCTGGATTTCTGTCCACTGG - Intergenic
1176217341 20:63954466-63954488 ACGGGTGGAGGTCTGTCCCCAGG - Intronic
1178106024 21:29320068-29320090 ACTACTGAAGTTCAGTCCCAAGG - Intronic
1180291410 22:10853234-10853256 CCTACTGAATATCTGTCCCCAGG - Intergenic
1180494215 22:15882656-15882678 CCTACTGAATATCTGTCCCCAGG - Intergenic
1184240979 22:43211138-43211160 AGCACTGGGGTGCTGTCCCCAGG + Intronic
1184280834 22:43436559-43436581 ACTTCAGGAGCCCTGTCCCCCGG - Intronic
953787483 3:45921984-45922006 TCTAGTGGAGTTCTCTCCCTGGG + Intronic
954852294 3:53613870-53613892 ACTACGTGATTTCTGTCTCCTGG - Intronic
957193645 3:77040322-77040344 CCTACTGGTTTTCTTTCCCCCGG - Intronic
962073763 3:132058683-132058705 TCTATTGGATTTCTGACCCCTGG + Intronic
962480792 3:135796488-135796510 ACTACAGGAGTCCCATCCCCAGG - Intergenic
963331295 3:143919216-143919238 TCTACTGGAGGGCTTTCCCCAGG + Intergenic
966806708 3:183813464-183813486 AGTCCTGGAGTTCTGTACCATGG + Intergenic
970967714 4:21948114-21948136 ACAACTGTATTTTTGTCCCCTGG - Intronic
972056831 4:34814400-34814422 ACTGCTGGTTTTCTGTCTCCTGG - Intergenic
975742667 4:77445059-77445081 ACTACTGAAGTACTGGCCTCTGG - Intergenic
976601188 4:86938846-86938868 ACTACTGAAGTTCTGTCCTAAGG - Intronic
979160042 4:117448359-117448381 GCCAATGGAGTTCTGTTCCCAGG + Intergenic
981162402 4:141514212-141514234 ACTAAGGGAGTTCTGGGCCCAGG + Intergenic
981442549 4:144799481-144799503 GCCAATGGAGTTATGTCCCCAGG + Intergenic
981562894 4:146066618-146066640 ACTTGTGGAGGTCTGTCCTCAGG + Intergenic
986442231 5:7792586-7792608 ACTCCTGGAGGTCTGGCCCAGGG - Intronic
988278544 5:29114377-29114399 GCCAATGGAGTTATGTCCCCAGG + Intergenic
989727457 5:44603862-44603884 GCTAATGGAGTTATGTTCCCAGG - Intergenic
993834344 5:92798363-92798385 ACCACTGGATTTCAGTCCTCTGG + Intergenic
995460328 5:112396505-112396527 ACTCCTGGAGTTCTGACTCTTGG - Intronic
996245409 5:121257660-121257682 ATTAATGGAGTTCAGTCCCTTGG + Intergenic
998457146 5:142282139-142282161 CCTCCTGCAGTTCTGGCCCCAGG + Intergenic
999613789 5:153400210-153400232 ACTGCTGCAGGTCTTTCCCCAGG + Intergenic
1000674044 5:164098849-164098871 ACCACTGGAGCTCAGTTCCCTGG + Intergenic
1004871369 6:19907892-19907914 ACTACTGGACTTCTGCAGCCTGG - Intergenic
1006119756 6:31796528-31796550 AATACTGCAGCTCTGTCGCCAGG - Intergenic
1006333548 6:33409213-33409235 ACTACTAGAGTTCTGTCTAAAGG - Intronic
1008646559 6:53520404-53520426 GCTTCTGGAATGCTGTCCCCTGG - Intronic
1016810573 6:148257433-148257455 ACTACTTGAGGTCTGGCCTCGGG - Intergenic
1019757040 7:2778553-2778575 ACTTCAGGAGTTCAGACCCCTGG + Intronic
1020692815 7:11378623-11378645 ACTAATGCAGTTCTGTGCCAGGG - Intronic
1022905619 7:34852533-34852555 GCTTCTGGAATTCTTTCCCCAGG + Intronic
1023589013 7:41761363-41761385 ACTGCTGGAGTTCTGTCTAATGG + Intergenic
1023728130 7:43164744-43164766 AGTCCTGGAGATCTGACCCCAGG - Intronic
1024174758 7:46827695-46827717 ACCAATGGAGTTATGTTCCCAGG - Intergenic
1025236949 7:57240891-57240913 ACAGCTGGAGTTCAGTCCCATGG - Intergenic
1026243622 7:68598595-68598617 AGTAATTGAGGTCTGTCCCCTGG - Intergenic
1037653950 8:20867072-20867094 ACCACTGGAATTCGGTCACCTGG - Intergenic
1045053880 8:98352159-98352181 ACTACTGGAGTTCTGACAAAAGG + Intergenic
1048823086 8:138397728-138397750 ACTCCTGGAGCTCTGTCCATGGG - Intronic
1049795741 8:144496562-144496584 AGTCCTGGAGTCCTGGCCCCAGG - Exonic
1049808717 8:144553620-144553642 ACCACTGGACCTCTGTCCCAAGG + Intronic
1050616031 9:7402585-7402607 ACTACTGGAGTGTAATCCCCTGG + Intergenic
1053470878 9:38345534-38345556 ACTGATGGACTTCTGTCTCCAGG + Intergenic
1054810310 9:69429068-69429090 ACTACTGGAGTTCTGTCCCCTGG + Exonic
1056964494 9:91154732-91154754 ACAACTGAAGCCCTGTCCCCGGG + Intergenic
1057394398 9:94666921-94666943 AGTACTGTAGTGATGTCCCCAGG + Intergenic
1058721162 9:107765805-107765827 GCTACTGGAGCTCAGTCCCATGG + Intergenic
1060207676 9:121691902-121691924 ACTTTTGGAGTTCTGTTCCCTGG - Intronic
1061700607 9:132412185-132412207 ACGACTGGGGTTCTGTCTTCAGG + Intronic
1062075070 9:134583460-134583482 CCTACTGCATGTCTGTCCCCAGG - Intergenic
1186584361 X:10856650-10856672 TGTAGTGGAGTTCTGTCCCTAGG - Intergenic
1188979970 X:36718218-36718240 ACTACTGGATATCTGTACCAGGG - Intergenic
1190829226 X:54045051-54045073 GCTACCCGCGTTCTGTCCCCAGG + Exonic
1192229706 X:69256455-69256477 ACTGCAGGAGTTCTCTCCCATGG + Intergenic
1193196938 X:78643532-78643554 GCTAATGGAGTTGTGTTCCCAGG - Intergenic
1193647571 X:84088495-84088517 ACTCTGGGAGTTCTGTCCCAGGG + Intronic
1196224350 X:113147936-113147958 ACAACTTGAGGTCTGTCACCAGG + Intergenic
1201676129 Y:16586408-16586430 TCTACTGGAGTTTTCTCACCAGG + Intergenic