ID: 1054813304

View in Genome Browser
Species Human (GRCh38)
Location 9:69451814-69451836
Sequence TTGTACAAACACTGCAATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 249}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054813304_1054813310 29 Left 1054813304 9:69451814-69451836 CCTAGATTGCAGTGTTTGTACAA 0: 1
1: 0
2: 0
3: 30
4: 249
Right 1054813310 9:69451866-69451888 ACCCACCCAAAACTTAGCTCAGG No data
1054813304_1054813307 6 Left 1054813304 9:69451814-69451836 CCTAGATTGCAGTGTTTGTACAA 0: 1
1: 0
2: 0
3: 30
4: 249
Right 1054813307 9:69451843-69451865 TTCAGGTCCTATCTGCCTCTGGG No data
1054813304_1054813306 5 Left 1054813304 9:69451814-69451836 CCTAGATTGCAGTGTTTGTACAA 0: 1
1: 0
2: 0
3: 30
4: 249
Right 1054813306 9:69451842-69451864 GTTCAGGTCCTATCTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054813304 Original CRISPR TTGTACAAACACTGCAATCT AGG (reversed) Intronic
902475574 1:16683242-16683264 TTCAACAAACAATGAAATCTTGG + Intergenic
903441960 1:23394887-23394909 CTGTCCAAACACTGCATCCTAGG + Intronic
908647947 1:66300036-66300058 TTGCACAAACACAGACATCTAGG + Intronic
909994564 1:82263348-82263370 TTATCCAAGCACTGCAGTCTTGG + Intergenic
913424358 1:118710665-118710687 GTGTAAAACCACTGCAATTTTGG - Intergenic
914840420 1:151243763-151243785 CAGTAGAAACACTGCCATCTTGG - Intronic
917183314 1:172322851-172322873 TTAAACAAACACTGCATCCTTGG - Intronic
919800975 1:201354435-201354457 TGGCCCAAGCACTGCAATCTGGG + Intergenic
921709832 1:218362903-218362925 TTTTAAGAACACTGAAATCTAGG + Intronic
1064399728 10:15011617-15011639 GTGTACAACCCCTGCAATATTGG - Intergenic
1064818511 10:19295817-19295839 TTGTTAAAACACAGGAATCTTGG + Intronic
1071149709 10:82620037-82620059 TTGTACAAAGAATGCACTTTGGG + Intronic
1072794361 10:98343111-98343133 TTGTGAAAACACTGTAAACTGGG + Intergenic
1074030090 10:109678346-109678368 TTGAACAAGCACTACAAACTGGG + Intergenic
1075192984 10:120328571-120328593 TTGGACATAAACAGCAATCTAGG - Intergenic
1078805634 11:14698426-14698448 TTGAACCAACACTGTATTCTTGG + Intronic
1078832590 11:14991702-14991724 GTGTACAACCCCTGCAATATTGG - Intronic
1079038429 11:17040972-17040994 ATGTACACCCACTGCAATATTGG + Intergenic
1079779368 11:24580986-24581008 TTGTTCAACAAATGCAATCTAGG - Intronic
1080673608 11:34404290-34404312 TTGTACAAACTTTACAATATGGG + Intergenic
1080895480 11:36445850-36445872 TTGTATAAATACTGTAATTTAGG - Intronic
1081449816 11:43160620-43160642 TTGTACATCCCCTGCAATATTGG - Intergenic
1081450768 11:43169081-43169103 GTGTACAACCCCTGCAATATTGG + Intergenic
1081451059 11:43171410-43171432 GTGTACAACCCCTGCAATATTGG - Intergenic
1084811844 11:71616762-71616784 TTGTACACACCCTGCGATATTGG + Intergenic
1085602433 11:77867297-77867319 TTCTACAACCACTGCATTCAAGG + Intronic
1089309220 11:117546905-117546927 TTGTACACACACTGCAGATTGGG + Intronic
1090117754 11:123993123-123993145 TTGTAAAAACACTGGAATAATGG - Intergenic
1090153669 11:124413349-124413371 CTGTACAAAAACTGCTATCTAGG - Intergenic
1092431981 12:8417456-8417478 TTGTACAACCCCTGCGATATTGG - Intergenic
1092435747 12:8445417-8445439 GTGTACAACCACTGCGATATTGG + Intergenic
1095230717 12:39735952-39735974 TTGGAGAAACACTGCCAGCTTGG + Intronic
1095255455 12:40030688-40030710 TTGTAAAAATACTGCATCCTGGG - Intronic
1095697290 12:45156581-45156603 GTGTACACTCACTGCAATATAGG - Intergenic
1097429985 12:59493666-59493688 TTGAGCAAGCACTGCAATCTCGG + Intergenic
1097435262 12:59546893-59546915 TTGTACACGCCCTGCAATATTGG - Intergenic
1098479707 12:70944069-70944091 GTGTACAAGCCCTGCAATATTGG + Intergenic
1100137992 12:91578695-91578717 TTGTACAAGAACTGAAATCCAGG + Intergenic
1100416552 12:94383532-94383554 AAGTTCAAACACTGTAATCTGGG + Intronic
1107448300 13:40487122-40487144 TTGTACTAATGGTGCAATCTTGG + Intergenic
1107743281 13:43477763-43477785 TTGTAGAAACAATGAAAACTTGG - Intronic
1109354812 13:61222935-61222957 TTGTACACCCCCTGCAATATTGG - Intergenic
1113217496 13:108060163-108060185 TCCTACAATCACTGCACTCTCGG - Intergenic
1113855935 13:113445518-113445540 TTGTACTAAAACTGCACTCTGGG + Intronic
1114435913 14:22707763-22707785 ATGTACACACGCTGCAATGTGGG + Intergenic
1114436184 14:22709523-22709545 GTGTACAAGCCCTGCAATATGGG + Intergenic
1114436898 14:22714120-22714142 GTGTACACTCACTGCAATTTTGG - Intergenic
1114853396 14:26408130-26408152 ATGTACAAATTCTGAAATCTAGG + Intergenic
1116144096 14:41041365-41041387 TAATACAAACAATGTAATCTAGG - Intergenic
1116255418 14:42548384-42548406 TGGTACATCCACTGAAATCTTGG + Intergenic
1116517189 14:45817232-45817254 ATGTACAACCCCTGCAATATTGG + Intergenic
1116517411 14:45818425-45818447 TTGTACATTCCCTGCAATATTGG + Intergenic
1116519950 14:45835043-45835065 TTGTACACACCCTGCAATATTGG + Intergenic
1117830538 14:59745509-59745531 TTGTACAAAGGTTGCAATCTGGG - Intronic
1118710812 14:68518097-68518119 TTGAACAAACGCTGCCTTCTGGG - Intronic
1118966088 14:70586981-70587003 CTGTACAAACAATGCAATTTAGG + Intronic
1120480283 14:85040831-85040853 TAGTACAGAAAATGCAATCTCGG - Intergenic
1121618587 14:95330889-95330911 TTGAAAAATCACTGCTATCTGGG - Intergenic
1122505458 14:102229065-102229087 TTGTAAAACCACCGCATTCTAGG - Exonic
1202828596 14_GL000009v2_random:2983-3005 TTGTACACCCCCTGCAATATGGG - Intergenic
1202900360 14_GL000194v1_random:32974-32996 TTGTACACACCCTGCAATATGGG - Intergenic
1123804066 15:23853296-23853318 CTGAACAAAAACTGCAAACTTGG - Intergenic
1126557133 15:50001507-50001529 TTGTACAGACAATGAAATCAAGG - Intronic
1127825099 15:62696129-62696151 ATGGAGAAACACTGCAGTCTAGG - Intronic
1131159787 15:90098166-90098188 TTGCACAAACACTGTCCTCTTGG + Intronic
1133991021 16:10707688-10707710 TTGTAAACCCACTGCAATGTGGG + Intergenic
1137278727 16:46956666-46956688 TTGTACAAACTTTACAATGTGGG + Exonic
1137955839 16:52828129-52828151 ATGTACAACCCCTGAAATCTTGG - Intergenic
1139661124 16:68421527-68421549 TTGCACAAACACTGCCAGGTTGG - Intronic
1141678082 16:85528073-85528095 TTGCACAAACCCTGCAAACAGGG + Intergenic
1142812837 17:2403451-2403473 TTTTACAACCATTGCAAACTTGG - Intergenic
1146109900 17:30079542-30079564 TTGCAGAAAGTCTGCAATCTTGG + Intronic
1146423265 17:32709831-32709853 CTGTACTAACACTGCCATGTAGG + Intronic
1150305170 17:64078706-64078728 TTGCAAAAACACTGTAAGCTGGG + Intronic
1150375318 17:64676592-64676614 TAGTACAAACACAGCTACCTGGG + Intergenic
1153482501 18:5561418-5561440 TTGTTCAAATTCTTCAATCTTGG - Intronic
1156329551 18:36106788-36106810 TTGGTCAAACACTGTAAACTGGG + Intergenic
1158663979 18:59415647-59415669 TTGTCCAAAAACTCTAATCTTGG - Intergenic
1159676016 18:71285196-71285218 TTAGACAAACATTTCAATCTAGG + Intergenic
1163920501 19:20284180-20284202 TTGTAATATCACTGCACTCTTGG - Intergenic
1166236463 19:41460589-41460611 TTGTACACCCCCTGCAATTTTGG + Intergenic
1166238270 19:41472261-41472283 TTGTACACACCCTGCGATATTGG + Intergenic
1202644103 1_KI270706v1_random:124827-124849 TTGTACACCCCCTGCAATATGGG + Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
926431031 2:12785896-12785918 CTGTACAACCTCTGAAATCTAGG + Intergenic
926712472 2:15892375-15892397 TTCTACCAACTATGCAATCTTGG - Intergenic
927612317 2:24553611-24553633 TTGAACCAACATTGCATTCTTGG + Intronic
927625542 2:24713346-24713368 TTGTTGAAACACTGTAATCTGGG - Intronic
928785587 2:34882236-34882258 TAGTAGAAACAATGCAATGTAGG - Intergenic
929236278 2:39608510-39608532 CTGTCCAAACACTGCATTTTAGG + Intergenic
930328616 2:49953772-49953794 TTATACAAACACTGCATCGTGGG - Intronic
930680567 2:54253498-54253520 TTGAAGAAACACTGCAATTTTGG - Exonic
932350152 2:71024923-71024945 TTGTACACACACTTCGATATTGG + Intergenic
932353641 2:71051057-71051079 TTGTACACACACTTCGATATTGG + Intergenic
934506472 2:94898365-94898387 TTGTACACCCCCTGCAATATGGG + Intergenic
937781514 2:125843912-125843934 TAATACAAAGACTGCATTCTTGG + Intergenic
938000652 2:127732991-127733013 TATTACAAACACTACATTCTTGG - Intronic
938098711 2:128482158-128482180 TTGAACCAACATTGCATTCTGGG - Intergenic
940869908 2:158850903-158850925 GTGTACAAACCCTGCGATATTGG + Intronic
941533179 2:166693861-166693883 TTGTACAATCCCTGCGATATTGG + Intergenic
941693524 2:168526925-168526947 GTGTTCAAACGCTTCAATCTGGG - Intronic
942317319 2:174707998-174708020 TTGTACACCCCCTGCAATATTGG + Intergenic
943998069 2:194797140-194797162 TTGTACATCCTCTGAAATCTAGG - Intergenic
1169725361 20:8723487-8723509 TTGTGCCAACACTGCATTATTGG + Intronic
1171894070 20:30743773-30743795 TTGTACACCCCCTGCAATATGGG + Intergenic
1172821557 20:37739552-37739574 ATGTACATACCCTTCAATCTGGG - Intronic
1173109223 20:40170027-40170049 CTGGATAAACACTGGAATCTGGG + Intergenic
1174165943 20:48583698-48583720 GTGTACAAAAACTGCCAGCTGGG + Intergenic
1174398869 20:50265029-50265051 TTGGACAAATACAGTAATCTGGG + Intergenic
1174527073 20:51181293-51181315 TTACAAAAACAATGCAATCTTGG - Intergenic
1176607778 21:8847811-8847833 TTGTACACCCCCTGCAATATGGG - Intergenic
1176619734 21:9047752-9047774 TTGTACACACCCTGCAATATGGG - Intergenic
1176711445 21:10153334-10153356 TTGTACAAAGACTACAAGTTAGG - Intergenic
1177169572 21:17640526-17640548 TTGTACATCCTCTGAAATCTAGG + Intergenic
1177788576 21:25697401-25697423 CAGTAGAAATACTGCAATCTTGG + Intronic
1179310730 21:40193718-40193740 TTTTACAAACACTGCAAAATAGG - Intronic
1180357863 22:11857609-11857631 TTGTACACCCCCTGCAATATGGG - Intergenic
1180380404 22:12134724-12134746 TTGTACACCCCCTGCAATATGGG + Intergenic
1181788170 22:25242684-25242706 TTGGACAGAAACTGCTATCTCGG - Intergenic
1181953599 22:26572194-26572216 TTGAACCAACACTGCAGTCTGGG - Intronic
955558200 3:60160435-60160457 TTGTAAAAACAATGCAAAATAGG - Intronic
955649968 3:61183530-61183552 TGTTACAAACTGTGCAATCTTGG + Intronic
956645518 3:71451961-71451983 TTCTTGAAACACTGCACTCTAGG - Intronic
956830037 3:73037803-73037825 TTGTACCATCACTGAAATCTCGG + Intronic
957075786 3:75602454-75602476 TTGTACAATTACTTCAATATTGG - Intergenic
957691102 3:83570678-83570700 TTGGACAAACACTGCAAAACAGG + Intergenic
959403634 3:105933723-105933745 TTTTACAAAAACTTCAATATAGG - Intergenic
960754624 3:120997904-120997926 TTGAACAAACCTTGCATTCTAGG - Intronic
964888984 3:161516051-161516073 GTGTACAACCCCTGCAATATGGG + Intergenic
965349636 3:167597344-167597366 TTGTACATCCTCTGAAATCTAGG - Intronic
965399623 3:168200613-168200635 GTGTACAACCCCTGCAATATTGG + Intergenic
967449240 3:189604254-189604276 TTCCACATACCCTGCAATCTAGG - Intergenic
967722002 3:192825845-192825867 TTGTCCAAACACTTCCATGTGGG - Intronic
968716431 4:2163236-2163258 TTCTACAAAAACTGCAATTCTGG - Intronic
969789264 4:9480810-9480832 GTGTACACACACTTCAATATTGG + Intergenic
971746271 4:30585579-30585601 CTGTGGAAACCCTGCAATCTAGG - Intergenic
973080156 4:45980702-45980724 TTCTACAAACAATGAGATCTGGG + Intergenic
973371193 4:49249687-49249709 TTGTACACCCACTGCGATATTGG - Intergenic
973389811 4:49545624-49545646 TTGTACACCCACTGCGATATTGG + Intergenic
973390094 4:49547373-49547395 GTGTACAACCCCTGCAATATTGG + Intergenic
974112326 4:57539540-57539562 TTGTAATATCACTGCAGTCTTGG + Intergenic
975912656 4:79285830-79285852 TAATACAAACACTTCAATGTTGG + Intronic
977953774 4:103003524-103003546 TTGTAGAAACACCTCAATCTAGG + Intronic
979423749 4:120538703-120538725 TTGGAGAAACACTTCATTCTAGG - Intergenic
982448220 4:155519995-155520017 TTGCACAAACAGTGCCATCTAGG - Intergenic
983624596 4:169790028-169790050 ATGTACATACCCTGCAATATTGG + Intergenic
984551529 4:181165610-181165632 TCGTATCAACACTGTAATCTAGG + Intergenic
985091610 4:186368539-186368561 TTGTTCACCCACTGGAATCTGGG - Intergenic
985757266 5:1726374-1726396 GTGTGCAAACACTGCATTCCTGG + Intergenic
986949935 5:13070894-13070916 TTATACATCCACTGAAATCTAGG + Intergenic
987618158 5:20303744-20303766 TTCTTCAAGCACTGCAATCATGG - Intronic
988995060 5:36706807-36706829 TTGGAGAACCACTGCCATCTGGG - Intergenic
993314574 5:86385328-86385350 TTGTACAAAAATTCCAATTTTGG + Intergenic
993413195 5:87596603-87596625 TTGTACATCCTCTGAAATCTAGG + Intergenic
993491368 5:88555387-88555409 TTTTATAAACACTGCAAGCATGG + Intergenic
994080302 5:95701295-95701317 TAGTAAAAACACTGCTAGCTTGG + Intergenic
994392567 5:99204412-99204434 TTGTACATTCCCTGCAATATTGG + Intergenic
994393124 5:99208158-99208180 TTGTACACCCACTGCGATATAGG + Intergenic
994393248 5:99208833-99208855 TTGTACAACCCCTGCAGTATGGG + Intergenic
994396079 5:99226721-99226743 TTGTACACACCCTGCAATATTGG + Intergenic
994396347 5:99228541-99228563 GTGTACACCCACTGCAATATTGG + Intergenic
994999740 5:107112185-107112207 TTGAACACATATTGCAATCTAGG - Intergenic
996136165 5:119845006-119845028 TTGCCCAAACTTTGCAATCTGGG - Intergenic
997246594 5:132355301-132355323 TTGTACATCCTCTGAAATCTAGG - Intergenic
997682783 5:135767833-135767855 GTGTACAAACTCTGCGATATTGG - Intergenic
997685154 5:135783306-135783328 TTGTACACCCCCTGCAATATTGG - Intergenic
997686812 5:135794637-135794659 TTGTACACCCCCTGCGATCTTGG - Intergenic
997687973 5:135801949-135801971 GTGTACACCCACTGCAATATTGG - Intergenic
997751586 5:136351501-136351523 TGGTGCAAACACTGAAAGCTGGG + Intronic
998550573 5:143073690-143073712 ATGTACACACACTGCAGTCAAGG + Intronic
998980560 5:147697767-147697789 TTGTACATCCTCTGAAATCTAGG - Intronic
999369910 5:151048449-151048471 TTTTACCAGCACTGCAACCTTGG - Intronic
1001552001 5:172609672-172609694 TTTTGCAAACACTGCAAACCAGG + Intergenic
1003262289 6:4529700-4529722 ATGTTCAAAGACTGCATTCTGGG + Intergenic
1004217932 6:13719584-13719606 TTGTACAAAAATTACAATTTGGG + Intergenic
1005816826 6:29559788-29559810 CTGGACAAACACAGCAATCCAGG - Exonic
1009046620 6:58242811-58242833 GTGTACAACCTCTGCAATATGGG - Intergenic
1009048137 6:58251905-58251927 TTGTACACCCCCTGCAATATTGG - Intergenic
1009048525 6:58254398-58254420 TTGTACACACCCTGCAATATTGG - Intergenic
1009048591 6:58254835-58254857 TTGTACAACCCCTGCGATATTGG - Intergenic
1009222430 6:60997123-60997145 GTGTACAACCTCTGCAATATGGG - Intergenic
1009224020 6:61006686-61006708 GTGTACAACCCCTGCAATATTGG - Intergenic
1009224393 6:61009156-61009178 TTGTACACACCCTGCAATATTGG - Intergenic
1009224454 6:61009596-61009618 TTGTACAACCCCTGCGATATTGG - Intergenic
1009224635 6:61010874-61010896 GTGTACAACCCCTGCAATCCTGG + Intergenic
1009364735 6:62849207-62849229 GTGTACACCCACTGCAATATTGG - Intergenic
1009367917 6:62870028-62870050 GTGTACAACCCCTGCAATATTGG - Intergenic
1009369202 6:62879885-62879907 TTGTACAACCACCGCAATATTGG - Intergenic
1009460487 6:63907027-63907049 GTGTACACACTATGCAATCTTGG - Intronic
1013622026 6:111899326-111899348 TTCTACAAACACTGCCATTTCGG + Intergenic
1013918064 6:115366136-115366158 TGATACGAACAATGCAATCTAGG + Intergenic
1021869532 7:24990693-24990715 TTGTTCAAAAACTACAATCTAGG + Intergenic
1023238669 7:38118278-38118300 TTGAACCAATCCTGCAATCTAGG - Intergenic
1023663765 7:42497855-42497877 TTGTTAAAACACTACAATTTTGG + Intergenic
1024680890 7:51686460-51686482 TTGTAAATACTCTGCTATCTGGG - Intergenic
1029012862 7:97281161-97281183 CTGTCCAAACAATGCAATGTGGG + Intergenic
1029343671 7:99963692-99963714 GTGTACATACTCTGCAATATTGG - Intergenic
1035673311 8:1436650-1436672 CTCTACACACACTGCAAACTTGG - Intergenic
1036144268 8:6239144-6239166 ATGTACAAACATTGGCATCTTGG - Intergenic
1036905602 8:12706381-12706403 TTGTACAACCCCTGCCATATTGG - Intergenic
1037095988 8:14988728-14988750 TTGTGAAAATACTGCATTCTGGG + Intronic
1038451316 8:27640990-27641012 TTTTAAAAATACTGCAAGCTGGG - Intronic
1039915145 8:41854626-41854648 TTTTACAAATACTCCCATCTGGG - Intronic
1040975034 8:53181494-53181516 TTGAACAAACTTTGCATTCTTGG + Intergenic
1043633862 8:82367491-82367513 GTGTACAACCCCTGCAATATTGG - Intergenic
1043635085 8:82375197-82375219 GTGTACAATCCCTGCAATATTGG - Intergenic
1045924168 8:107567271-107567293 GTGTACACACCCTGCAATATGGG - Intergenic
1045924814 8:107571538-107571560 TTGTACATTCTCTGCAATATAGG - Intergenic
1045927714 8:107590935-107590957 GTGTACACACCCTGCAATATGGG - Intergenic
1047130185 8:122010210-122010232 TTATACAATCACTGCATTTTTGG + Intergenic
1050698897 9:8314512-8314534 TTGTAAAGACACTCCAAGCTGGG + Exonic
1052676765 9:31636187-31636209 CTGTACAACCACTGCCATTTGGG + Intergenic
1054354576 9:64049006-64049028 TTGTACACCCCCTGCAATATGGG - Intergenic
1054744228 9:68838400-68838422 GTGTACAAAGAATGCACTCTTGG - Intronic
1054813304 9:69451814-69451836 TTGTACAAACACTGCAATCTAGG - Intronic
1055901865 9:81248774-81248796 TTTTTCAACCACTGCATTCTGGG + Intergenic
1056608219 9:88105272-88105294 TTGAACCAACATTGCATTCTAGG - Intergenic
1057776890 9:98018680-98018702 TTCCACACTCACTGCAATCTTGG - Intergenic
1057859930 9:98633036-98633058 ATCTACAAACACTACAACCTAGG - Intronic
1058130392 9:101246126-101246148 TTGTATAAGCACTGAAATCTAGG + Intronic
1058518160 9:105795821-105795843 GTGTACAACCACTGCGATATTGG + Intergenic
1058518352 9:105797109-105797131 GTGTACAAACTCTGCGATATTGG + Intergenic
1058518787 9:105799822-105799844 GTGTACAACCTCTGCAATATTGG + Intergenic
1058519090 9:105801739-105801761 GTGTACACACACTGCGATATTGG + Intergenic
1058519109 9:105801890-105801912 TTGTACACCCTCTGCAATATTGG + Intergenic
1059174985 9:112161520-112161542 TTGTAGATAGAATGCAATCTTGG + Intronic
1202796198 9_KI270719v1_random:122323-122345 TTGTACAAAGACTACAAGTTAGG - Intergenic
1203742914 Un_GL000218v1:18130-18152 TTGTACACCCCCTGCAATATGGG - Intergenic
1203703125 Un_KI270742v1:12705-12727 TTGTACACCCCCTGCAATATGGG - Intergenic
1203554221 Un_KI270743v1:192330-192352 TTGTACACCCACTGCGATATTGG + Intergenic
1203567182 Un_KI270744v1:101307-101329 TTGTACACCCCCTGCAATATGGG + Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1187529048 X:20080088-20080110 TTGTAGAAACACAGGAAGCTAGG - Intronic
1187534428 X:20125933-20125955 TTCAACAAACAATGAAATCTTGG + Exonic
1188977022 X:36688417-36688439 TTGTACATACTCTCCATTCTTGG - Intergenic
1190168592 X:48093490-48093512 TTATACAAACCCTGCCATATTGG + Intergenic
1190217788 X:48491670-48491692 GTGTACAGACACCACAATCTAGG - Intergenic
1190739052 X:53276890-53276912 TTGAACAATCCCTGCACTCTTGG + Intronic
1192335627 X:70217011-70217033 TCGTACATCCTCTGCAATCTAGG - Intergenic
1197961868 X:132015948-132015970 CTGTACAGACACTGCAGACTCGG + Intergenic
1199432591 X:147777724-147777746 TTGTAGAAACACTGCCATGGTGG - Intergenic
1201156444 Y:11135599-11135621 TTGTACACCCCCTGCAATATGGG - Intergenic