ID: 1054814213

View in Genome Browser
Species Human (GRCh38)
Location 9:69459293-69459315
Sequence GACAATTAGGTCAATTAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054814210_1054814213 8 Left 1054814210 9:69459262-69459284 CCGTAGTTGTTAGGGACAGTGTT 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1054814213 9:69459293-69459315 GACAATTAGGTCAATTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054814213 Original CRISPR GACAATTAGGTCAATTAAGG TGG Intronic
No off target data available for this crispr