ID: 1054814288

View in Genome Browser
Species Human (GRCh38)
Location 9:69460219-69460241
Sequence GAACAGCAGGGCATCTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054814288 Original CRISPR GAACAGCAGGGCATCTGTGT GGG (reversed) Intronic
900008260 1:79824-79846 GAACAGCAGGGGGTGTGGGTAGG - Intergenic
900073464 1:792291-792313 GAAAAGCAGGGCATCCCTGGAGG - Intergenic
900779552 1:4608915-4608937 GAACTGCAGAGCATGTGTGCTGG - Intergenic
900889359 1:5438374-5438396 GCCCAGTAGGGCCTCTGTGTGGG + Intergenic
901133323 1:6976567-6976589 GAGCAGTAGAGCATCTGTGATGG + Intronic
901624052 1:10613553-10613575 GAAGAGACGGGCATCTGTGGTGG - Intronic
904061773 1:27716762-27716784 GAAAAGCAAGGCTTCTGTTTTGG - Intergenic
904567092 1:31434558-31434580 GAACACCAGGGCTTCAGTGCCGG - Exonic
905629127 1:39509133-39509155 GCACAGCAGGGCTGCTGGGTGGG - Intronic
907779148 1:57549376-57549398 GAACAGCAGCGGGTCTGTGAAGG + Intronic
910092962 1:83487289-83487311 GAATAGCAGGGCATTTATTTAGG - Intergenic
910757440 1:90707711-90707733 GAAAACCAGGTCATCTGTCTCGG - Intergenic
922269331 1:224017200-224017222 GAAAAGCAGGGCATCCCTGTAGG - Intergenic
922354934 1:224766654-224766676 GAACACCATGGCATCTGGGATGG - Intergenic
922450572 1:225734066-225734088 CCTCAGCAGGGCATCTGTGCAGG - Intergenic
923375044 1:233353222-233353244 GAACAGAAAGACATCAGTGTGGG - Intronic
1064606806 10:17050507-17050529 GGAAAGCCGGGCATCTGAGTAGG + Intronic
1065081513 10:22134239-22134261 GAACAGCAGTGGATCTAGGTAGG - Intergenic
1065172227 10:23042854-23042876 GAAAAATAAGGCATCTGTGTTGG - Intergenic
1066278222 10:33889336-33889358 GAATATCAGGGCAGCTGTGGTGG - Intergenic
1067782928 10:49222056-49222078 GACTAACAGGGGATCTGTGTGGG + Intergenic
1068758325 10:60680281-60680303 GAGCAGCAGTGAATCTGTATGGG - Intronic
1072302253 10:94072866-94072888 GCTCACCAGTGCATCTGTGTGGG - Intronic
1074967258 10:118502200-118502222 GAACAGCAGGGCACCATCGTGGG - Intergenic
1075247194 10:120833167-120833189 GAACAGAAGGGATGCTGTGTGGG - Intergenic
1075428820 10:122363900-122363922 CTACAGCAGGACACCTGTGTTGG + Intergenic
1076601991 10:131663289-131663311 GAACAGCAGGGTATCAGGGAGGG - Intergenic
1081687211 11:45051439-45051461 GAAGAGGAGGGCATCTCGGTTGG + Intergenic
1081975158 11:47229222-47229244 GATCAGAAGGGCATCCATGTAGG + Intronic
1083477109 11:62921742-62921764 GAATACCAGGGCATGTGTGTTGG - Intronic
1083771225 11:64868739-64868761 GTACAGCAGGGCACCTGAGGAGG + Intronic
1084303935 11:68269505-68269527 GCACACGTGGGCATCTGTGTTGG - Intronic
1084427109 11:69090383-69090405 GATGAGCAGGGCATCTCTGTGGG - Intronic
1085693815 11:78687187-78687209 GAAGAGCAGGGGTTCTGGGTGGG - Intronic
1086390872 11:86361417-86361439 GAAAAGCGGGCCATCTGTTTAGG + Intergenic
1086943387 11:92820984-92821006 AAGGAGCAGTGCATCTGTGTTGG + Intronic
1088762299 11:112943414-112943436 AATCAGCAGGGCATATGTTTGGG + Intergenic
1090968977 11:131623434-131623456 GGACAGCATGGCATCTGTCTCGG - Intronic
1092210558 12:6643635-6643657 CACCAGCAAGGCCTCTGTGTGGG + Exonic
1093154863 12:15670195-15670217 AAACAGCAGGCTATCTGTATGGG + Intronic
1095804144 12:46300005-46300027 GAAAAGCAGGCCATCTGTGCAGG - Intergenic
1096577950 12:52566281-52566303 GAACAGGAGGCAATATGTGTAGG + Exonic
1096669318 12:53189086-53189108 GAACAGAAGGGCTTTTGTTTTGG + Exonic
1106585495 13:31053300-31053322 CATCAGCAGGTCATCTGTGGTGG + Intergenic
1107695432 13:42994894-42994916 GAACAGCAGGGCCTTTCTGGAGG + Intergenic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1112629578 13:101146047-101146069 GAACAGGAGGGCTTCTTTTTGGG + Intronic
1117839663 14:59846501-59846523 GAACAGAAGGGTGTCTGGGTAGG - Intronic
1120384767 14:83830508-83830530 AAACATCAGAGCATCTATGTAGG - Intergenic
1123678236 15:22734637-22734659 GAATAGTAGGGCATCTGATTTGG + Intergenic
1124330428 15:28808904-28808926 GAATAGTAGGGCATCTGATTTGG + Intergenic
1128328300 15:66739409-66739431 GGACAGAAGGGGCTCTGTGTTGG - Intronic
1129265218 15:74389705-74389727 CCACAGCGGGGCCTCTGTGTGGG + Intergenic
1130868523 15:87952391-87952413 GCACAGCAGGGAAGCTCTGTTGG + Intronic
1131056685 15:89379100-89379122 GAATAACCGGGCATCTGTCTGGG - Intergenic
1132445295 15:101912286-101912308 GAACAGCAGGGGGTGTGGGTAGG + Intergenic
1137368653 16:47883854-47883876 GAACAAAAGGGCATCTGGGTGGG - Intergenic
1137494405 16:48958673-48958695 GACCAGGAGGGCCACTGTGTGGG - Intergenic
1138618261 16:58189673-58189695 GAATAGCAGGGCAACTCTGAAGG + Intronic
1142265392 16:89062027-89062049 GAGCAGCAGGGCCCCTGTGTGGG - Intergenic
1143202286 17:5121403-5121425 GCTCTGCAGGGCCTCTGTGTTGG - Exonic
1143329442 17:6122358-6122380 GAACAGCTTCGCATCAGTGTGGG - Exonic
1144627132 17:16849734-16849756 GCTCTGCAGGGCCTCTGTGTTGG + Intergenic
1144879307 17:18422978-18423000 GCTCTGCAGGGCCTCTGTGTTGG - Intergenic
1145152931 17:20521409-20521431 GCTCTGCAGGGCCTCTGTGTTGG + Intergenic
1146705601 17:34998674-34998696 GACCACCAGGTCAGCTGTGTCGG - Exonic
1147614685 17:41821014-41821036 GGCCTGCAGGGCATGTGTGTGGG + Exonic
1151895200 17:76975317-76975339 CAACAGTAGGTCATCTCTGTAGG - Intergenic
1155421989 18:25665755-25665777 AAGCAGCTGGGCATCTGAGTGGG + Intergenic
1157245723 18:46052678-46052700 GAACAGAAGGGAATTTGTTTTGG - Intronic
1158373115 18:56831799-56831821 GAAAAGCATAGCATCTGGGTTGG - Intronic
1160640014 19:121421-121443 GAACAGCAGGGGGTGTGGGTAGG - Intergenic
1161431159 19:4233197-4233219 GAACAGCTGGACATCCGTGATGG - Exonic
1164396735 19:27871861-27871883 GAAAAGCTGTGCATCTGTGAGGG + Intergenic
1164783587 19:30912454-30912476 GAACAGTAGGGCGTGTGTGTAGG - Intergenic
1165139314 19:33689452-33689474 GCACACCAGGGCAGCTGTGGAGG - Intronic
1165174362 19:33916530-33916552 GATGAGGAGGGTATCTGTGTGGG + Intergenic
1165635693 19:37337824-37337846 AAACAGCCTGGCAACTGTGTTGG - Intronic
1167095012 19:47370586-47370608 GCACAGCAGGGCTTCAGTGTGGG + Intronic
1168610516 19:57795710-57795732 GAAAAGCTGGGCATCTGTTTTGG - Intronic
925319405 2:2950754-2950776 GAAGAGCGGGGCAGCCGTGTGGG - Intergenic
925647110 2:6046655-6046677 GAAAAGCAGGGCATCTACGAAGG + Intergenic
925761771 2:7191785-7191807 GAACAGCAGAGCCCCTGTGTAGG - Intergenic
925781935 2:7389332-7389354 GCCCAGTAGGGGATCTGTGTGGG + Intergenic
930893088 2:56413496-56413518 TAGCAGCAAGGCATCTGAGTTGG + Intergenic
931979983 2:67684390-67684412 GAAAAGCAAGTTATCTGTGTGGG - Intergenic
932614588 2:73223773-73223795 GAAAAGCAAGGCTTCTGTCTCGG + Intronic
932951096 2:76294506-76294528 AGACAGCAGAGCATCTGTGAAGG + Intergenic
936661864 2:114551725-114551747 TATCAGTAGGGCATCTGTGCAGG + Intronic
937882626 2:126880145-126880167 GAGTGGCAGGGCATGTGTGTGGG - Intergenic
938051751 2:128179345-128179367 CTAAAGCAGGGCCTCTGTGTAGG + Intronic
938067296 2:128288056-128288078 GAGCAGCAGGGCAGCTGACTAGG + Intronic
939437526 2:142198016-142198038 GAAAATCAGGTCATCTGTGAGGG + Intergenic
939577840 2:143917584-143917606 GGAGAGGAGGACATCTGTGTAGG - Intergenic
940402852 2:153267278-153267300 AAAGAGCAGGGACTCTGTGTGGG + Intergenic
941912351 2:170775678-170775700 GAACAGCACGGCATCTTTTGGGG - Intergenic
946896851 2:224332917-224332939 GAACAGCCTTGGATCTGTGTGGG - Intergenic
948504003 2:238415615-238415637 GCACAGGAGGGGCTCTGTGTGGG + Intergenic
1169287834 20:4324455-4324477 GAACACCAGGGCTTCAGTCTAGG - Intergenic
1169972384 20:11282316-11282338 AAGCTGCAGGGCATCTGTGAAGG + Intergenic
1170951339 20:20938868-20938890 CCGCAGCTGGGCATCTGTGTGGG + Intergenic
1172129527 20:32646562-32646584 CAACAGCAGGCCATCAGTGTGGG - Intergenic
1173326522 20:42038501-42038523 GGAAGGAAGGGCATCTGTGTGGG + Intergenic
1174539043 20:51275046-51275068 GACCAGCAGGGCTTGTGGGTGGG + Intergenic
1182041654 22:27242903-27242925 CAACAGCCGGTCATCTGGGTGGG + Intergenic
1182067584 22:27441683-27441705 GAACAGAACGGAATCTTTGTGGG - Intergenic
1184877461 22:47284556-47284578 GAGGAGCAGGGACTCTGTGTGGG - Intergenic
1184967258 22:47988617-47988639 CAGCAGCAGGGAATCTGTATTGG - Intergenic
949226906 3:1705641-1705663 GACCAGCACAGCATCTGTGCTGG - Intergenic
952488874 3:33846075-33846097 GAATAGTAGGGCATCTGATTTGG + Intronic
952538449 3:34339326-34339348 GAACAGCAAGGCGGCTGTGGCGG - Intergenic
956551231 3:70461806-70461828 GCCCAGCAGGGACTCTGTGTGGG - Intergenic
956872919 3:73435777-73435799 GACCAGCCTGGCAACTGTGTAGG - Intronic
958846098 3:99266714-99266736 GAACACCTGGGAATCTGTGTTGG + Intergenic
958904863 3:99930755-99930777 GAACTGCAGGTCAGCTGGGTTGG - Exonic
960154398 3:114283315-114283337 GACCAGCAGGCAATCTGTGGGGG + Intronic
968035716 3:195545758-195545780 GAAAAGCAGGCCATGTGTGGTGG - Intergenic
968608083 4:1545045-1545067 GAGCAGCATGGGCTCTGTGTGGG - Intergenic
970315091 4:14821451-14821473 GAACTCCAGGACATCTTTGTTGG + Intergenic
970572784 4:17399055-17399077 GTCCAGCAGGGCCTCTGTGAAGG + Intergenic
971065900 4:23032951-23032973 GGAGAGCATGGCATCTTTGTAGG - Intergenic
973054709 4:45641329-45641351 GAAAAGCATGGCATCTGTTAAGG - Intergenic
974291921 4:59944277-59944299 GGAGAGGAGGGCATCTGAGTAGG - Intergenic
980008461 4:127567950-127567972 GAACAATAGGACATCTGTGTAGG + Intergenic
980549100 4:134309898-134309920 GAACAGGAGGGAAGCTGGGTAGG + Intergenic
981010074 4:139916441-139916463 TGACAGCAGGCCACCTGTGTGGG + Intronic
984656479 4:182324126-182324148 GAACTGTAGGACTTCTGTGTGGG - Exonic
985843278 5:2325713-2325735 GAGCAGCTGCACATCTGTGTGGG - Intergenic
986674564 5:10171702-10171724 GAAAAGTTGGGCAACTGTGTGGG - Intergenic
987876741 5:23689939-23689961 GACAATCAGGGCACCTGTGTGGG + Intergenic
991655194 5:68896956-68896978 GAACATCAGGGCCTCTGCCTTGG + Intergenic
992070931 5:73148307-73148329 GAACAACTGGGTATATGTGTGGG + Intergenic
1002747364 6:69828-69850 GAACAGCAGGGGGTGTGGGTAGG - Intergenic
1002837196 6:874878-874900 GAAATTTAGGGCATCTGTGTGGG + Intergenic
1003053352 6:2798907-2798929 GAACAGCAGGGCTAGTGTGGGGG + Intergenic
1004418734 6:15448698-15448720 GAAAAGCAGGGCAGTTGTGTTGG + Intronic
1005707270 6:28468451-28468473 TAACAGCAGAGCATATGTGAAGG + Intergenic
1005882269 6:30070753-30070775 GACCAGCAGAGCCTCTATGTAGG + Exonic
1007735346 6:43978855-43978877 GGACAGCAGGGCTGCTGTGCGGG - Intergenic
1010636026 6:78260280-78260302 GTCCAGTAGGGTATCTGTGTGGG + Intergenic
1010767354 6:79791294-79791316 GATGAGGAGGGCATCTTTGTGGG - Intergenic
1011404278 6:87001433-87001455 AAACACCAGGGCTTCTGTCTAGG + Intronic
1013373891 6:109495723-109495745 GTACAGCATGGCATCTGCCTGGG - Intronic
1013870066 6:114746651-114746673 TAAGATCAGGGCATCTGTGAAGG - Intergenic
1013932740 6:115554235-115554257 TCACAGCAGGGCACCTGTGACGG - Intergenic
1014084461 6:117327262-117327284 GAGCAGCAGGGCAGCAGAGTTGG + Intronic
1016352454 6:143182977-143182999 GAACAGCAGGTCATGTGTGCAGG - Intronic
1024659577 7:51480307-51480329 AAACAGCTGGTCATCTGTTTAGG - Intergenic
1027309820 7:76943784-76943806 GAATAGCAGGGCATTTATTTAGG - Intergenic
1029872706 7:103711944-103711966 GAATAGCAGGTCAGCTGTGGTGG - Intronic
1035542191 8:449297-449319 GAAAAGCAGGGCATCCCTGGAGG + Intronic
1037452396 8:19028892-19028914 GAACAACAGGACATCTATCTGGG - Intronic
1038404716 8:27312912-27312934 TAACAGCAGTGAATCTGTATGGG + Intronic
1039164492 8:34662423-34662445 GAACAGCAAGACCTGTGTGTTGG + Intergenic
1039853373 8:41391536-41391558 GAACAGCAAAGCACCTGTGGCGG - Intergenic
1041820919 8:62032059-62032081 GAACAGCAGAGCATTTCTTTTGG - Intergenic
1042601812 8:70506312-70506334 GAAGAGCTGGGCATTTGTGCAGG + Intergenic
1046520427 8:115318598-115318620 GAGCAGCAGGCCTGCTGTGTTGG - Intergenic
1047013284 8:120695501-120695523 GAGAAGCAGAGCATCTGTCTGGG - Intronic
1049028835 8:140017436-140017458 GAACAACTGGACGTCTGTGTGGG - Intronic
1052036357 9:23685597-23685619 GCACACCAGGGCTTATGTGTGGG - Intergenic
1053202722 9:36163678-36163700 ACTCAGCAGGGCATCTGGGTTGG - Exonic
1054814288 9:69460219-69460241 GAACAGCAGGGCATCTGTGTGGG - Intronic
1055979599 9:81989027-81989049 CAACAACAGGGCATCTCTCTTGG - Intronic
1057050086 9:91916951-91916973 GAAAAGCAGAGCGTCTGTGGGGG - Intronic
1058254342 9:102742697-102742719 GATCAGGAGGGAATCTATGTGGG + Intergenic
1059239660 9:112793325-112793347 GAACATGAAGGCATCTGGGTTGG - Intronic
1061847490 9:133395869-133395891 GATAATCAGGGCATCTGTGATGG - Intronic
1061965095 9:134009024-134009046 GCACAACATGGCGTCTGTGTTGG + Intergenic
1190088784 X:47419522-47419544 CAAAAGCAGGGCATCTGTGCTGG - Intergenic
1192733735 X:73828184-73828206 AAATAGAAGAGCATCTGTGTTGG - Intergenic
1195689254 X:107610344-107610366 GCAAAGCAGGGAAGCTGTGTGGG + Intergenic
1198568797 X:137933622-137933644 GACCAGCCTGGCATCTGTCTTGG + Intergenic