ID: 1054814921

View in Genome Browser
Species Human (GRCh38)
Location 9:69465763-69465785
Sequence GGGGCTTCCCCTAAAAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054814910_1054814921 23 Left 1054814910 9:69465717-69465739 CCTGTTGGGAGCCATGGGGCAAG 0: 1
1: 0
2: 4
3: 23
4: 249
Right 1054814921 9:69465763-69465785 GGGGCTTCCCCTAAAAGAACTGG No data
1054814911_1054814921 12 Left 1054814911 9:69465728-69465750 CCATGGGGCAAGACACATCTCTT 0: 1
1: 0
2: 2
3: 16
4: 174
Right 1054814921 9:69465763-69465785 GGGGCTTCCCCTAAAAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054814921 Original CRISPR GGGGCTTCCCCTAAAAGAAC TGG Intronic
No off target data available for this crispr