ID: 1054819027

View in Genome Browser
Species Human (GRCh38)
Location 9:69503777-69503799
Sequence CATGTGGCCTGCCGCTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054819027_1054819033 -9 Left 1054819027 9:69503777-69503799 CCCTCTGAGCGGCAGGCCACATG 0: 1
1: 0
2: 1
3: 3
4: 101
Right 1054819033 9:69503791-69503813 GGCCACATGGGATTGGTGGTTGG No data
1054819027_1054819036 15 Left 1054819027 9:69503777-69503799 CCCTCTGAGCGGCAGGCCACATG 0: 1
1: 0
2: 1
3: 3
4: 101
Right 1054819036 9:69503815-69503837 CTTCTGCATGGTTGTGATCCTGG No data
1054819027_1054819035 3 Left 1054819027 9:69503777-69503799 CCCTCTGAGCGGCAGGCCACATG 0: 1
1: 0
2: 1
3: 3
4: 101
Right 1054819035 9:69503803-69503825 TTGGTGGTTGGACTTCTGCATGG No data
1054819027_1054819037 16 Left 1054819027 9:69503777-69503799 CCCTCTGAGCGGCAGGCCACATG 0: 1
1: 0
2: 1
3: 3
4: 101
Right 1054819037 9:69503816-69503838 TTCTGCATGGTTGTGATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054819027 Original CRISPR CATGTGGCCTGCCGCTCAGA GGG (reversed) Intronic
900770912 1:4543365-4543387 CTGGTGGCCTGCTGCTTAGAGGG + Intergenic
901422775 1:9162236-9162258 CATGTGACCTGCCCCCCAGCCGG + Intergenic
901742655 1:11352377-11352399 CATGGGGGCTGCGGCTCAGGGGG - Intergenic
902340440 1:15779802-15779824 CATGTGGCTTGGTGATCAGAAGG + Intronic
903173072 1:21565503-21565525 CATGGGGACTGCTCCTCAGAGGG + Intronic
903274148 1:22210174-22210196 CATGTGGCCTGTCCCACAGCAGG - Intergenic
906830618 1:49027635-49027657 CTTGTGGCCTGCCCCTCCCAAGG - Intronic
919753244 1:201051321-201051343 CATGAGGGCTGCAGCACAGAGGG - Intronic
920137096 1:203778731-203778753 CATGGGGCCTGGCACTCAGAAGG + Intergenic
922219896 1:223550429-223550451 CCTGTGGGCTGGGGCTCAGAGGG + Intronic
1063959875 10:11298223-11298245 CATGTGACCCGACCCTCAGAAGG - Intronic
1069857278 10:71448255-71448277 CATGTGGCCAGCCCTTCAGCAGG + Intronic
1069868380 10:71518276-71518298 CCTGTGTCCTGCCTCCCAGAGGG + Intronic
1070728473 10:78808587-78808609 CATGGGGCCTTCTGATCAGACGG - Intergenic
1075079229 10:119371567-119371589 CATGTGGCCTGCTTCCGAGAAGG + Intronic
1087306798 11:96499025-96499047 CATATGGCTTGCTGCTCAGCAGG - Intronic
1089699652 11:120236846-120236868 CATGTGCCCTGAGGCTTAGAAGG - Intronic
1090090235 11:123690301-123690323 CATGTGGTCTCCCTCTCAGCTGG + Intergenic
1091843238 12:3635246-3635268 CAGGTGGCCTGTCCCCCAGAGGG - Intronic
1100014514 12:89992821-89992843 CATTTGGCCTTCCTCTGAGATGG + Intergenic
1103324118 12:120109047-120109069 CATGTGGGCTGCTGCCCTGATGG - Intronic
1108525855 13:51285412-51285434 CATGTGGCCTGGGGCGGAGAAGG - Intergenic
1121251185 14:92500570-92500592 CATGGGGTCTGCAGCTTAGAGGG - Exonic
1128746722 15:70120001-70120023 CATGTGGCCTGCCGTTAAGAGGG + Intergenic
1129235354 15:74220538-74220560 CACGTGGCCTGTGGCTCAGGTGG - Intergenic
1133510828 16:6455457-6455479 CATGTTGCCTGCCACTCAACGGG - Intronic
1135210369 16:20520892-20520914 CATGCGTCCTGACGCCCAGAGGG - Intergenic
1136250276 16:28999851-28999873 CTTCTGGCCTGCCACTCACATGG + Intergenic
1136293970 16:29291397-29291419 CATGAGGGCTGCGGCACAGAGGG + Intergenic
1137721035 16:50627594-50627616 CATCTGCCCTGGCACTCAGAAGG - Intronic
1138299425 16:55913901-55913923 CATGTTGCCTGCAGCTCACTAGG + Intronic
1142099874 16:88265443-88265465 CATGAGGGCTGCGGCACAGAGGG + Intergenic
1142192709 16:88725263-88725285 CATGGGGCCTGCCAGACAGAGGG + Intronic
1145812689 17:27774024-27774046 CTAGTGGCCTGTGGCTCAGATGG - Intronic
1146186241 17:30726376-30726398 CATGTGGGCTGTTGCACAGAAGG - Intergenic
1146515444 17:33485668-33485690 CTTCTTGCCTGCCTCTCAGAGGG + Intronic
1146782121 17:35683667-35683689 CATGTTGCCTGAAGCCCAGAAGG - Intronic
1151663107 17:75530030-75530052 CGTGTGGCCTGCCACACAGCAGG + Intronic
1152610465 17:81312802-81312824 TATGTGGTCTGCCGCCCAGCAGG - Exonic
1153616615 18:6940819-6940841 CACGTGCACTGCCGCTGAGACGG + Intergenic
1154054659 18:11001219-11001241 CATATGGTCTCCAGCTCAGAAGG + Intronic
1160273022 18:77404406-77404428 CATGTGGCATGCCGCCGACATGG + Intergenic
1160498964 18:79393214-79393236 CATCTGGCCTGCGGTTCAGTAGG + Intergenic
1160669152 19:348537-348559 GATGTGGGCCGCCCCTCAGAGGG - Intergenic
1160890055 19:1372999-1373021 CAAGTGGCCTGCGGTTAAGAAGG - Intronic
927936233 2:27078404-27078426 CTTGAGGCCAGCCTCTCAGATGG - Intergenic
929747566 2:44674664-44674686 TATGTGGCCTGCAGCCCAGCAGG - Intronic
930968789 2:57368450-57368472 CAAGGGGCCTGCTGCTCTGAGGG - Intergenic
930981779 2:57534524-57534546 CATTTTGCCTGCTGCCCAGATGG - Intergenic
935205266 2:100891332-100891354 CACGTGACCTGCAGCTCTGATGG + Intronic
935205276 2:100891410-100891432 CACGTGACCTGCGGCTCTGAAGG + Intronic
944166365 2:196726203-196726225 CATCTGGCCTGCTGATCAAAGGG - Intronic
947013550 2:225592004-225592026 CATGTGGTCTGCTGCCCAGTGGG + Intronic
947799650 2:232920724-232920746 CCTGGAGCCTGCCGCTGAGATGG - Intronic
1168924396 20:1567262-1567284 CATGTGGGCTGCCCCTTAGAAGG - Intronic
1169120546 20:3093157-3093179 CCTGGGGCCTGGGGCTCAGACGG - Intergenic
1170902714 20:20481418-20481440 AATGTGGCCTGCCTCTCGGTAGG - Intronic
1172592052 20:36124727-36124749 CATGTGGCATGGCGCACAGTAGG + Intronic
1176159046 20:63639350-63639372 TCTGTGGCCCGCCGCTCAGGAGG - Intergenic
1178944488 21:36935256-36935278 CATGTGGCCTGCAGCACTGCAGG + Intronic
1179541186 21:42084116-42084138 CCTGGGGCCTGCCCCGCAGAGGG + Exonic
1179629455 21:42667573-42667595 CACTTGGCCTGCTTCTCAGATGG + Intronic
1181235488 22:21445708-21445730 CATGTTGGCTGTCGCTCAGCTGG - Exonic
1182709503 22:32311727-32311749 CATGGGGCCTGGCGCACAGCAGG + Intergenic
1183747577 22:39700416-39700438 TATCTGGCCTGGCTCTCAGAAGG - Intergenic
1184033873 22:41909696-41909718 CCTGTGGCCTGAGGCTCCGACGG + Exonic
949578649 3:5364140-5364162 GAGGTGGTCTGACGCTCAGAGGG + Intergenic
955655678 3:61242543-61242565 CATTTTGCCTGCTGCCCAGATGG + Intronic
957640640 3:82849321-82849343 GATGTGGCCAGCCCCTCACAAGG + Intergenic
961529034 3:127528570-127528592 CATGGTGCCTGCAGCTCTGAGGG - Intergenic
968703393 4:2067136-2067158 CATGTGGTCTGGCCCCCAGAAGG + Exonic
972806437 4:42533329-42533351 CATGTAGCCTGCAGCCCAAAAGG - Intronic
976427716 4:84925340-84925362 CATGTGGCTTGCTGCTCCCATGG + Intronic
979396380 4:120194397-120194419 CATGTTAGCTGCAGCTCAGAGGG - Intergenic
982931076 4:161407953-161407975 GCTGTGGCCTGTGGCTCAGAAGG + Intronic
986053671 5:4114204-4114226 CCTGTAGCATGCCGCTCACAGGG - Intergenic
996332958 5:122351945-122351967 GATGTGGCCTGCCTCCTAGAGGG - Intronic
997855491 5:137369024-137369046 CATCCGGCCTGGTGCTCAGATGG + Intronic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
1004167838 6:13272566-13272588 CAAGTGGACTGCAACTCAGACGG - Intronic
1005897391 6:30189856-30189878 GATGTGTCCTGCTCCTCAGAAGG + Intronic
1007427812 6:41758621-41758643 CATGAGGCCTGGGGCTGAGATGG + Intergenic
1016899996 6:149091970-149091992 CATGTGGCCTGGCTCTCCAAGGG - Intergenic
1017527461 6:155254265-155254287 CATGTGGCCTCCCGTACAGAAGG - Intronic
1026534562 7:71229207-71229229 GATGTGGCCCAGCGCTCAGATGG + Intronic
1032765803 7:134991884-134991906 CATGAGGCCTGCCATTCAGCAGG + Intronic
1038779106 8:30555946-30555968 CATGAGCCCTGCCGCTCTGCCGG + Intronic
1039568128 8:38565439-38565461 CATCTGGGCTGCCGGGCAGACGG - Intergenic
1041249380 8:55919714-55919736 CAGCTGGCCTCCCGCTGAGAAGG - Intronic
1045605477 8:103768824-103768846 CATGTGTCCTGCAGCACAAATGG + Intronic
1051539201 9:18195344-18195366 CATGTAGCCTGGCACACAGATGG - Intergenic
1051638196 9:19200512-19200534 CATGTGTCCTGCAGCACAAACGG - Intergenic
1054819027 9:69503777-69503799 CATGTGGCCTGCCGCTCAGAGGG - Intronic
1055637366 9:78292232-78292254 CATGAGGGCTGCCTCACAGAAGG - Intergenic
1056378236 9:86035053-86035075 CATGTGGCCTGCCTGCCAGGAGG + Intronic
1057952936 9:99384497-99384519 CAGGTGGCCTTCCGGTCAGCAGG + Intergenic
1058131447 9:101258411-101258433 CATGTGCCAAGCCCCTCAGAGGG - Intronic
1061679415 9:132235698-132235720 CAGGTGGCCTCCCGTGCAGAAGG + Intronic
1062071374 9:134556745-134556767 CCTGTGGACTGCAGCCCAGATGG + Intergenic
1062233006 9:135493091-135493113 CCTGGGGCCTCCCTCTCAGATGG - Intergenic
1062279133 9:135744232-135744254 CAGCTGGCCTGCCGGTCAGCAGG + Intronic
1187364218 X:18653328-18653350 CATGTGGCCTTCTGCTCCGTGGG + Intronic
1198305612 X:135379724-135379746 TATGTAGCCTCCTGCTCAGAGGG - Intergenic
1201347781 Y:13004079-13004101 CAGGTGGCCTGCAGGTCACAAGG + Intergenic
1202379555 Y:24263418-24263440 CATGGGGCCTGTGGCCCAGAGGG - Intergenic
1202491227 Y:25406703-25406725 CATGGGGCCTGTGGCCCAGAGGG + Intergenic