ID: 1054821516

View in Genome Browser
Species Human (GRCh38)
Location 9:69525924-69525946
Sequence GACTTCGACTGAAGATCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 85}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054821516_1054821518 -4 Left 1054821516 9:69525924-69525946 CCATCTGATCTTCAGTCGAAGTC 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1054821518 9:69525943-69525965 AGTCAAGAAAAATAAGCGACGGG No data
1054821516_1054821517 -5 Left 1054821516 9:69525924-69525946 CCATCTGATCTTCAGTCGAAGTC 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1054821517 9:69525942-69525964 AAGTCAAGAAAAATAAGCGACGG No data
1054821516_1054821519 -3 Left 1054821516 9:69525924-69525946 CCATCTGATCTTCAGTCGAAGTC 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1054821519 9:69525944-69525966 GTCAAGAAAAATAAGCGACGGGG No data
1054821516_1054821520 2 Left 1054821516 9:69525924-69525946 CCATCTGATCTTCAGTCGAAGTC 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1054821520 9:69525949-69525971 GAAAAATAAGCGACGGGGAAAGG No data
1054821516_1054821521 22 Left 1054821516 9:69525924-69525946 CCATCTGATCTTCAGTCGAAGTC 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1054821521 9:69525969-69525991 AGGACTCCTTGTTCAATAAATGG No data
1054821516_1054821523 29 Left 1054821516 9:69525924-69525946 CCATCTGATCTTCAGTCGAAGTC 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1054821523 9:69525976-69525998 CTTGTTCAATAAATGGTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054821516 Original CRISPR GACTTCGACTGAAGATCAGA TGG (reversed) Intronic
904738060 1:32650475-32650497 CAATTTGACTGAAGAACAGAAGG - Exonic
906189538 1:43887562-43887584 GACGTGGAGTGAAGATGAGAGGG + Intronic
910621309 1:89258505-89258527 GATTTGAACTGAAGTTCAGAAGG - Intergenic
1065275899 10:24085451-24085473 GACTTGCACTGAAGACCAGAAGG - Intronic
1067971140 10:50972384-50972406 GAGTTCCCCTGAAGATCAGTAGG + Intergenic
1074373309 10:112918271-112918293 TTCTTAGACTGAAGCTCAGATGG - Intergenic
1081084039 11:38776920-38776942 GACTTTTGCTGATGATCAGATGG - Intergenic
1086177086 11:83903834-83903856 CATTTCCACTGAAGATAAGAAGG - Intronic
1087700762 11:101433968-101433990 CCCTTCCACTGAAGATCTGAGGG + Intergenic
1087983099 11:104641726-104641748 GACATTGACTGAATATTAGATGG + Intergenic
1088467738 11:110159617-110159639 GACTCCCACTGAGGATCAGTGGG - Intronic
1088591529 11:111407915-111407937 GACTTCCAATGAGAATCAGAAGG + Intronic
1089656360 11:119949814-119949836 GACATCTGCTGAAGATCACATGG + Intergenic
1092101168 12:5884857-5884879 GACTTCTAATGGAGAGCAGAGGG + Intronic
1105477218 13:20739020-20739042 GAATACGTCTGAACATCAGAAGG - Intronic
1111344119 13:86926330-86926352 GACTTTGACTGAGGAGCATAAGG + Intergenic
1111934754 13:94547480-94547502 GAATTCGACTGAAGGGCATAAGG - Intergenic
1116772406 14:49142844-49142866 CAGTTTGACAGAAGATCAGAAGG + Intergenic
1117197250 14:53353036-53353058 GAATTCGACTGAGGAGCATAAGG - Intergenic
1123027351 14:105432954-105432976 GCTTTCGACTGAAGCTCAGGCGG - Intronic
1123431009 15:20216337-20216359 GAATTCGACTGAGGGGCAGAAGG - Intergenic
1125041138 15:35188620-35188642 GAATTCGACTGAGGGACAGAAGG - Intergenic
1128932656 15:71719256-71719278 CATTTGGACTGAAAATCAGAAGG - Intronic
1129965574 15:79732175-79732197 AATTTCGTCTGAAGAGCAGAGGG - Intergenic
1133679136 16:8104242-8104264 GAATTCGACTGATGGTCAAAAGG - Intergenic
1139284665 16:65800141-65800163 GACTTCGAGTTAAGGTTAGACGG + Intergenic
1139500258 16:67357695-67357717 GACTCCGAATGAAGAGCAAACGG + Intronic
1139638396 16:68273409-68273431 GATTTCTTCTGAAGATGAGATGG + Intronic
1141833659 16:86524011-86524033 CACTTTGAATGAAGAGCAGAAGG + Intergenic
1147256265 17:39184218-39184240 GACTCGGACTGAGGAACAGAAGG - Intronic
1152762593 17:82116842-82116864 GACCTAGACTGGAGACCAGAGGG - Intronic
928479757 2:31670239-31670261 GTCTTGGACTTAAGATCTGAAGG + Intergenic
930746882 2:54893688-54893710 GGCTTCAACTGGAGGTCAGAGGG - Intronic
932734958 2:74248037-74248059 GTCTTGGGCTGAAGGTCAGAAGG - Intronic
933936373 2:87207143-87207165 GAATTCGACTGAAGAGCATAAGG + Intergenic
936356776 2:111758686-111758708 GAATTCGACTGAAGAGCATAAGG - Intergenic
937045932 2:118851830-118851852 CATTTCGAGTGTAGATCAGATGG + Intergenic
938465791 2:131524095-131524117 GAATTCGACTGAGGAGCATAAGG - Intergenic
943810086 2:192174571-192174593 GATTTCAATTGAAGTTCAGATGG + Intronic
944553655 2:200867399-200867421 GAATTCGACTGAGGGGCAGAAGG - Intergenic
946188553 2:217995366-217995388 GACATCATCTGAAGTTCAGAAGG + Intronic
1170359345 20:15527624-15527646 GCCTTACACTGATGATCAGATGG - Intronic
1171909053 20:30924324-30924346 GAATTCAACTGAAGTTCATATGG - Intergenic
1172094188 20:32452657-32452679 GACTTCATCTGGAGACCAGAGGG - Intronic
1184809587 22:46822248-46822270 GAACTGGACAGAAGATCAGATGG - Intronic
952553292 3:34503093-34503115 GACTTAGAATGAGGATGAGAGGG + Intergenic
953203311 3:40797502-40797524 GACCTCGAATGAAGAAAAGAGGG - Intergenic
956479751 3:69661587-69661609 GAACACGACTGAACATCAGAAGG + Intergenic
957878563 3:86180982-86181004 GACTTAGGCTGAAGGGCAGATGG + Intergenic
959054632 3:101555007-101555029 GATTTCAACTGAGGAGCAGAAGG - Intergenic
965906067 3:173708295-173708317 GACCTTGGCTGAAGAGCAGAAGG + Intronic
967786840 3:193506468-193506490 GACCTGGACTGAAAAACAGAGGG + Intronic
969117464 4:4880104-4880126 GACTTTCACTGGAGATCATAAGG + Intergenic
972961141 4:44453413-44453435 GAATAAGACTGAAGATAAGATGG + Intergenic
979940150 4:126752205-126752227 GAATTCGACTGAGGAGCATAAGG + Intergenic
980252543 4:130336134-130336156 GAACTCAACTGAAGATCATAAGG - Intergenic
983727059 4:170941394-170941416 GAACTGGACAGAAGATCAGATGG + Intergenic
985301741 4:188497195-188497217 GACATCGTAGGAAGATCAGAGGG - Intergenic
985339108 4:188929709-188929731 GAGATCAACAGAAGATCAGAAGG + Intergenic
986355641 5:6922620-6922642 GAGTTTTACCGAAGATCAGATGG + Intergenic
988317308 5:29646909-29646931 GACTTTGTCCAAAGATCAGATGG + Intergenic
1004271119 6:14196356-14196378 GAATTCGACTGAGGGCCAGAAGG - Intergenic
1006176748 6:32127179-32127201 GACTTCACCTGAAGATCTGGAGG + Exonic
1011288400 6:85749575-85749597 GAATTCGACTGAAGGCCATAAGG - Intergenic
1019618340 7:1977286-1977308 GAATTCGACTGCAGCGCAGATGG + Intronic
1023273001 7:38486696-38486718 GAATTCGACAGCAGATCAAAAGG + Intronic
1023893219 7:44409210-44409232 GACTTTGACTCAACATCAGCAGG + Intronic
1024645661 7:51368476-51368498 GACTTCGCCTGAGGCTCAGATGG - Intergenic
1025952152 7:66153723-66153745 GATTTCAGCTGAAGCTCAGATGG - Exonic
1026098192 7:67363846-67363868 GACCACGTCTGAACATCAGAAGG - Intergenic
1037958561 8:23078151-23078173 GAATTCGACTGAGGGTCATAAGG + Intergenic
1039185684 8:34913607-34913629 GACTTTGAGTGAAGATAGGATGG + Intergenic
1043959290 8:86397232-86397254 GAAAGCCACTGAAGATCAGATGG + Intronic
1045370834 8:101521136-101521158 GACTTGGAGTGAAGAAGAGAGGG + Intronic
1046000776 8:108418957-108418979 GTCTTTGACTGAAAATGAGAGGG - Intronic
1053621969 9:39828610-39828632 GATTTTGACTGAACACCAGAGGG - Intergenic
1053883115 9:42615658-42615680 GATTTTGACTGAACACCAGAGGG + Intergenic
1053889554 9:42678641-42678663 GATTTTGACTGAACACCAGAGGG - Intergenic
1054222140 9:62423131-62423153 GATTTTGACTGAACACCAGAGGG + Intergenic
1054228574 9:62486041-62486063 GATTTTGACTGAACACCAGAGGG - Intergenic
1054821516 9:69525924-69525946 GACTTCGACTGAAGATCAGATGG - Intronic
1187351892 X:18526517-18526539 GCCTTCCCCTTAAGATCAGAAGG - Intronic
1188955795 X:36434063-36434085 GAATTCGACTGAGGAGCACAAGG + Intergenic
1194756744 X:97747041-97747063 GAATTCGACTGAGGGTCAAAAGG + Intergenic
1195246956 X:103003555-103003577 CAGTTCTACTGAAGAGCAGAAGG - Intergenic
1195976481 X:110532887-110532909 GACTATGGCTGAAGAGCAGAAGG - Intergenic
1197123858 X:122921672-122921694 GATTTTTGCTGAAGATCAGATGG + Intergenic
1198239036 X:134765271-134765293 GAGGCCGACTGAAGATAAGAAGG - Intergenic
1198725992 X:139677450-139677472 GAATTCAACTGAAGGTCATAAGG - Intronic
1199594265 X:149494145-149494167 GACTTGGACTACAGAGCAGAGGG + Intronic