ID: 1054822928

View in Genome Browser
Species Human (GRCh38)
Location 9:69541956-69541978
Sequence GTATTAACTCAGATGGTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054822928 Original CRISPR GTATTAACTCAGATGGTCCA AGG (reversed) Intronic
902250520 1:15152139-15152161 GGATTAAATGAGATGGTTCAGGG + Intergenic
907600726 1:55766634-55766656 GTCTTAACTCAGCTGGGCCATGG - Intergenic
908248424 1:62246107-62246129 GGTTTAAATGAGATGGTCCATGG + Intronic
912239101 1:107886231-107886253 GTATAAACTGAGATACTCCATGG - Intronic
920604145 1:207363698-207363720 GTATCAATTAAGATGTTCCATGG - Intergenic
922581245 1:226699854-226699876 GTATTAACTCACATGATCACAGG + Intronic
923397110 1:233577188-233577210 GCATTAACTCACAGGTTCCAGGG + Intergenic
924596213 1:245447181-245447203 ATGTTAATTCAGATGGGCCACGG - Intronic
1064329542 10:14380652-14380674 CTATTATTTCAGATGGGCCAAGG + Intronic
1064667283 10:17668041-17668063 TTATTAACTCCGATGGACCTTGG - Intronic
1065255061 10:23857584-23857606 GTATTAAATCAGAAGGTCTAGGG + Intronic
1067563371 10:47319744-47319766 GGATTTTCTCAGATGGACCAGGG + Intergenic
1068446794 10:57135200-57135222 GTATTAACTCACATGGTCACAGG - Intergenic
1073799987 10:107031200-107031222 GTAATAATTCTCATGGTCCAGGG - Intronic
1073801986 10:107051565-107051587 ATATTAACTCAGGGGGTTCATGG + Intronic
1074127519 10:110541045-110541067 GTGTTAACACAGATGGCCAAAGG - Intergenic
1078627663 11:12972316-12972338 GTATAAACTCAGTTGGCTCATGG + Intergenic
1079044185 11:17085144-17085166 GTATTAACTAAGATGTTCCTAGG - Intronic
1084272478 11:68036654-68036676 GTCTTGACTCTGGTGGTCCAGGG + Intergenic
1085283301 11:75344692-75344714 GTATCATCTCAGATGGTTCCTGG - Intronic
1085283477 11:75345475-75345497 GTATCGTCTCAGATGGTCCCTGG - Intronic
1086635766 11:89082015-89082037 GTATTAACTCATATGATCACAGG - Intergenic
1086983462 11:93223771-93223793 GTATAAACTGAGGTGGTCCTGGG + Intergenic
1087675309 11:101154740-101154762 GTATTAACTCACATGATACAAGG + Intergenic
1088097969 11:106121761-106121783 GTGTTTACTCAGAAGTTCCAGGG - Intergenic
1090481030 11:127068421-127068443 GAACCAACTCAGCTGGTCCATGG + Intergenic
1090683958 11:129094909-129094931 GTATTAAATGAGATGATGCATGG + Intronic
1092800473 12:12160500-12160522 GTATTTGGTCATATGGTCCAAGG + Intronic
1097235887 12:57539331-57539353 GTACTTACACAGAGGGTCCAGGG + Intronic
1097454350 12:59778158-59778180 GTATTAACTCTGATGGGCCATGG + Intronic
1097628565 12:62031447-62031469 GTATTAACTCACATGATCACGGG - Intronic
1102567700 12:113807785-113807807 GTATTAATTCATTTGGTACAAGG + Intergenic
1102766949 12:115441618-115441640 GTATTAACTCACATGATCACAGG - Intergenic
1104560303 12:129837895-129837917 GTATTAACTTAGCCGTTCCAGGG - Intronic
1106666247 13:31853738-31853760 GTATTAACTCTGATGGACATGGG + Intergenic
1115860459 14:37680450-37680472 GCCTTAGCTCAGAAGGTCCATGG - Intronic
1117597178 14:57335209-57335231 GTATTAACTCACATGATCACAGG + Intergenic
1121307752 14:92917652-92917674 GTATTGACTCTGCTGTTCCATGG + Intergenic
1121915205 14:97832220-97832242 GTTTCAATTCAGATGGTCCAGGG - Intergenic
1125594051 15:40873290-40873312 GTACTAATTCAGCTGGACCAGGG - Exonic
1125841267 15:42803064-42803086 GTATTAACTCACATGATCACAGG - Intronic
1127715481 15:61645241-61645263 ATAGTAACTCAGGTGGTCCCAGG - Intergenic
1138726475 16:59145919-59145941 GTTTTAGCACACATGGTCCAAGG - Intergenic
1140678806 16:77363298-77363320 GTATTACCTAAGATGGTACTGGG + Intronic
1141499340 16:84432851-84432873 GTGCTAACACAGGTGGTCCAGGG + Intronic
1145774932 17:27521133-27521155 GTACTAAGTCAGCTGGCCCAGGG - Intronic
1146459296 17:33033180-33033202 GTCTTAACTCAGAAGGGTCAGGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1151134103 17:71928366-71928388 GTATTAATTCACATGGTCACAGG - Intergenic
1151164372 17:72191466-72191488 GCATTAACACACATGGTCAATGG + Intergenic
1151730746 17:75909829-75909851 GTATAAACTCCGATGAGCCATGG + Intronic
1155015877 18:21838829-21838851 GTATCAACACAGATGGTTCTTGG - Intronic
1155232067 18:23783575-23783597 GGATTAAGTGAGATGATCCAAGG + Intronic
1156190069 18:34708839-34708861 GGATTAAATGAGATAGTCCAAGG - Intronic
1161532525 19:4798678-4798700 GTATGAACTCTGACGGTCCTGGG - Exonic
1164558413 19:29270846-29270868 TTATTAACTCACATTTTCCATGG + Intergenic
925017024 2:536737-536759 GTATTAACTCATATGATCACAGG - Intergenic
926221641 2:10939927-10939949 GTATCAACTGAGATGGACCCTGG + Intergenic
928457678 2:31437996-31438018 CTGTTAACTCTGATGGTCCCTGG - Intergenic
929491005 2:42396246-42396268 GTATAAATACAGATGGTCCCTGG - Intronic
936541598 2:113356119-113356141 GTTTAAACACAGATGGCCCAAGG - Intergenic
938387017 2:130873826-130873848 GGATGAAATCAGATGGACCAGGG - Intronic
938654456 2:133416805-133416827 GGATAAACTCATTTGGTCCAGGG - Intronic
939092622 2:137797132-137797154 GTTTTTACTAAGATGGTCCAAGG - Intergenic
941063840 2:160878535-160878557 GTATTATCTCATATGGTGAAAGG - Intergenic
943094677 2:183414968-183414990 GAACTTTCTCAGATGGTCCATGG - Intergenic
945003662 2:205378453-205378475 GTTTTACCTCAGAAGGCCCAAGG + Intronic
948425027 2:237882031-237882053 GAATAAACTCCGATGGGCCAAGG - Intronic
1170271453 20:14531473-14531495 GTACTACCTCAGAAGGTACAGGG - Intronic
1172110058 20:32539255-32539277 GAATTCACTCAGCTGGCCCATGG - Intronic
1172123553 20:32612328-32612350 GTATAAACTGTGATGGTCCCAGG - Intergenic
1173903539 20:46608679-46608701 AGATTAACTTAGATGGTACACGG + Intronic
1176587376 21:8601218-8601240 GTATTAACTCAGATGATCACAGG + Intergenic
1180270207 22:10578215-10578237 GTATTAACTCAGATGATCACAGG + Intergenic
1182255515 22:29034915-29034937 GTATTAATTTAGTTGTTCCACGG - Intronic
949140043 3:620839-620861 GTATTAACTCAGACGATCACAGG - Intergenic
950465479 3:13150904-13150926 GTGTGAAAGCAGATGGTCCAGGG + Intergenic
958784307 3:98581049-98581071 GTAGAAACTCAGGTGATCCATGG + Intronic
959795362 3:110421474-110421496 GTGTCAACTCAGCTGGGCCATGG - Intergenic
964523147 3:157588178-157588200 GTATTAACTCACATGATCACAGG - Intronic
972027145 4:34396659-34396681 GTTTTAACCCAGATGATCCATGG - Intergenic
973133954 4:46683025-46683047 ATAATAATTCAGCTGGTCCAGGG - Intergenic
975083984 4:70315150-70315172 GTATAAATTCAGATGTTCCATGG - Intergenic
977238715 4:94541010-94541032 GTATACACGCAGATGGTACATGG - Intronic
977321852 4:95526227-95526249 GTATAAACTGAGATTGTCCTGGG - Intronic
978911911 4:114073912-114073934 CTATTAATCCATATGGTCCAGGG - Intergenic
979998943 4:127466042-127466064 GCATTAACTCATCTGTTCCATGG - Intergenic
980502453 4:133673858-133673880 TTTTTGACTCAGATGCTCCAGGG - Intergenic
985754862 5:1707594-1707616 GTACTAACTCCGAGGGCCCAGGG + Intergenic
986528379 5:8705778-8705800 GTAATAACTCAGATGACCCAGGG - Intergenic
988229095 5:28450828-28450850 GTATTAACTCACACGATCCCAGG - Intergenic
988271512 5:29023408-29023430 TTATTAACTCAGTTGATCCCAGG - Intergenic
989143087 5:38221437-38221459 TTATCAACTCAGCTGGTCCTTGG + Intergenic
992725503 5:79603197-79603219 GCACTAACTCAGAGGGTTCAGGG - Intergenic
992904684 5:81334590-81334612 GTATTAAATCATATGTTACATGG + Intronic
1000416566 5:160990570-160990592 GTATTAACTCACATGATCACAGG - Intergenic
1000436356 5:161214757-161214779 GTATTGAATCAGATGATCCACGG + Intergenic
1000624673 5:163525480-163525502 GTATTAACTTGGCTGGGCCATGG - Intergenic
1000626298 5:163543274-163543296 GTATGAATTCAGATGCTACATGG - Intergenic
1001787844 5:174428801-174428823 TTATTAACTCAACTGGTGCATGG + Intergenic
1004192377 6:13474900-13474922 GTATTTACTGAAATGGTTCATGG - Intronic
1004225679 6:13782267-13782289 GGATTAACTCAGATGCTTGAGGG - Intergenic
1004972102 6:20921999-20922021 GAAGTACCTCAGATGGTCCTGGG + Intronic
1005460607 6:26066310-26066332 GTATTAACTCCTAAGGTCCTGGG - Intergenic
1006771714 6:36558924-36558946 GAATTAAATCAGATTGTCAATGG - Intergenic
1007619626 6:43204037-43204059 GCATTAACTCAGGTGATCCCTGG - Intronic
1012456855 6:99416756-99416778 TTATTAACTTAGATGATACAAGG + Intronic
1013869979 6:114745380-114745402 GTATTTAATGAGATGTTCCAGGG + Intergenic
1018331248 6:162729280-162729302 GTAATAACTCAGATCTTCCCAGG - Intronic
1022047345 7:26632312-26632334 GAATTAACTCAAATGCTCCTTGG - Intergenic
1022258735 7:28684043-28684065 ATATTAACCAAGATGGTCAATGG + Intronic
1027249365 7:76389525-76389547 GGACTAACTCAGATGGTGCTCGG - Exonic
1028096036 7:86762271-86762293 GTATTAACTCAGAGCCTCCCTGG - Intronic
1038029856 8:23628400-23628422 GTATTAACTCAACTGGGCCATGG - Intergenic
1041664596 8:60430351-60430373 GTATTAAGGCAGCTGGTCCCTGG + Intergenic
1046132589 8:109985378-109985400 GTGTTAACTCACATGTTCCTGGG + Intergenic
1052390958 9:27878411-27878433 GAACTCACTCAGGTGGTCCAGGG + Intergenic
1054822928 9:69541956-69541978 GTATTAACTCAGATGGTCCAAGG - Intronic
1056518530 9:87378208-87378230 GTATTAACTCACATGATCTCAGG + Intergenic
1056825242 9:89872518-89872540 GTATTGACTCAGAGGGTCTGGGG + Intergenic
1057539581 9:95954023-95954045 GTATTAAATGAGATAATCCATGG - Intronic
1057768414 9:97944068-97944090 GTATTAACTCAAAAGGATCAGGG - Intronic
1058141331 9:101359349-101359371 GCATTAAATCAGAAGTTCCATGG + Intergenic
1058229932 9:102413194-102413216 GTATTAACTCACATGATCACAGG + Intergenic
1058544365 9:106044272-106044294 GTATTAACTCACATGATCACAGG + Intergenic
1059081796 9:111257768-111257790 GTATTTGCTCAGATGATACAAGG + Intergenic
1203617334 Un_KI270749v1:79400-79422 GTATTAACTCAGATGATCACAGG + Intergenic
1193234782 X:79093388-79093410 GTATCAAGTCAGATGTTCTAGGG - Intergenic
1193959540 X:87907530-87907552 ATATTAACTTATATGTTCCATGG - Intergenic
1195032046 X:100935823-100935845 GTGTTAACTCAGATTCTCCAAGG - Intergenic
1195866593 X:109439130-109439152 GTTGTGACTCAGCTGGTCCAAGG - Intronic
1198700835 X:139396578-139396600 GTATTAACTCACATGATCACAGG - Intergenic