ID: 1054824339 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:69557121-69557143 |
Sequence | ATACTATTATTCATAAAACA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1054824337_1054824339 | 9 | Left | 1054824337 | 9:69557089-69557111 | CCAAATCTAGAATATTGTATCCA | 0: 1 1: 0 2: 0 3: 36 4: 300 |
||
Right | 1054824339 | 9:69557121-69557143 | ATACTATTATTCATAAAACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1054824339 | Original CRISPR | ATACTATTATTCATAAAACA TGG | Intronic | ||
No off target data available for this crispr |