ID: 1054824339

View in Genome Browser
Species Human (GRCh38)
Location 9:69557121-69557143
Sequence ATACTATTATTCATAAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054824337_1054824339 9 Left 1054824337 9:69557089-69557111 CCAAATCTAGAATATTGTATCCA 0: 1
1: 0
2: 0
3: 36
4: 300
Right 1054824339 9:69557121-69557143 ATACTATTATTCATAAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054824339 Original CRISPR ATACTATTATTCATAAAACA TGG Intronic
No off target data available for this crispr