ID: 1054826744

View in Genome Browser
Species Human (GRCh38)
Location 9:69581027-69581049
Sequence CAGGGGACACAGATCAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054826738_1054826744 22 Left 1054826738 9:69580982-69581004 CCTCTGATATCTTATATCATTTA 0: 1
1: 2
2: 4
3: 48
4: 428
Right 1054826744 9:69581027-69581049 CAGGGGACACAGATCAAAGATGG No data
1054826739_1054826744 -4 Left 1054826739 9:69581008-69581030 CCAGTCATTTCCTGAGCAGCAGG 0: 1
1: 0
2: 1
3: 18
4: 209
Right 1054826744 9:69581027-69581049 CAGGGGACACAGATCAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054826744 Original CRISPR CAGGGGACACAGATCAAAGA TGG Intronic
No off target data available for this crispr