ID: 1054830912

View in Genome Browser
Species Human (GRCh38)
Location 9:69623572-69623594
Sequence AAGAACAATTAGATCTAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054830912_1054830915 23 Left 1054830912 9:69623572-69623594 CCTGACTAGATCTAATTGTTCTT 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1054830915 9:69623618-69623640 ATGCATATAAAAACCAGCTCGGG No data
1054830912_1054830917 27 Left 1054830912 9:69623572-69623594 CCTGACTAGATCTAATTGTTCTT 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1054830917 9:69623622-69623644 ATATAAAAACCAGCTCGGGAGGG No data
1054830912_1054830914 22 Left 1054830912 9:69623572-69623594 CCTGACTAGATCTAATTGTTCTT 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1054830914 9:69623617-69623639 AATGCATATAAAAACCAGCTCGG No data
1054830912_1054830916 26 Left 1054830912 9:69623572-69623594 CCTGACTAGATCTAATTGTTCTT 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1054830916 9:69623621-69623643 CATATAAAAACCAGCTCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054830912 Original CRISPR AAGAACAATTAGATCTAGTC AGG (reversed) Intronic
903729584 1:25482317-25482339 AAGAAAAATTAGATCTACAGAGG - Intronic
905866745 1:41381049-41381071 AAGAGCAATTAGTTCTAAACAGG + Intronic
909528866 1:76658997-76659019 AACAAAAATTAGAAGTAGTCAGG + Intergenic
916403810 1:164477088-164477110 AAGAACAGTGAGATCTGGTCGGG + Intergenic
917636484 1:176942048-176942070 AAAAACAATTAAATATATTCTGG - Intronic
917666870 1:177233669-177233691 AAGAATAATTGGATCTTCTCTGG + Intronic
917992169 1:180392085-180392107 AAGAAGAGTTAGAACTAATCAGG + Intronic
918269304 1:182881216-182881238 AACAACATTGTGATCTAGTCTGG + Intronic
918269966 1:182888843-182888865 AAGAACCATTAGTTTAAGTCAGG - Intergenic
918961856 1:191289354-191289376 AAGAACAATTACATTTTCTCTGG + Intergenic
920088550 1:203435698-203435720 AAGAACAACGAGATATATTCGGG - Intergenic
920395198 1:205640209-205640231 AAGAACAATCACATCTAATGGGG - Intergenic
921122806 1:212151354-212151376 AAGACCATATACATCTAGTCAGG - Intergenic
922523193 1:226275719-226275741 AAGAAAAAATAGCTCTAGGCTGG + Intronic
1067918728 10:50429874-50429896 AAGAACAATTGAAGCTATTCAGG + Intronic
1071943670 10:90616018-90616040 AACAACAATTAGGTCAATTCTGG + Intergenic
1072457534 10:95589869-95589891 AAGAAAAATGAGATCTGGCCAGG + Intergenic
1072605755 10:96981270-96981292 AGGAACAATTAGATGCAGTGAGG - Exonic
1075773769 10:124964926-124964948 ATGAACAATTAAGTATAGTCTGG - Intronic
1078469191 11:11573493-11573515 AAGGAAAATAAGACCTAGTCTGG - Intronic
1078471797 11:11593564-11593586 AAAAAAAATTAGATGTGGTCTGG - Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078912316 11:15744531-15744553 AAAAACCATTAGATCTTGTGAGG + Intergenic
1080115853 11:28621006-28621028 ATGAATAAATAGATCAAGTCTGG - Intergenic
1080215639 11:29836874-29836896 AAGAAGAATGTGATCTAATCTGG - Intergenic
1080327721 11:31096971-31096993 AAGAACATTTAGATTGAGACTGG + Intronic
1087507108 11:99038094-99038116 AAGAACAATTACCTTTAGTGAGG + Intronic
1088608763 11:111556936-111556958 AAGACCAATTAGATTCAGTTGGG - Intronic
1094535100 12:31314196-31314218 AAGAAAAATCAGATCCAGCCTGG + Intronic
1095200884 12:39382428-39382450 AAGAACAATTACAGGTAATCTGG + Intronic
1095417541 12:41993000-41993022 GAGAGGAATTAGATCTAGTTTGG + Intergenic
1101787620 12:107899076-107899098 AAGAAAAATTACATTTAGTGGGG - Intergenic
1102065850 12:109974764-109974786 AACATCAACTAGATCTAGTTGGG + Intronic
1102613084 12:114129663-114129685 AAGAACATTTAGGTCAAGACTGG + Intergenic
1102672369 12:114631001-114631023 CAGGATAATTAGATCTAGCCTGG - Intergenic
1103989302 12:124787502-124787524 AAGCAGAATTAGATCAAGTTTGG - Intronic
1105376261 13:19847947-19847969 AAGAAAAATTAAAACTAGTCCGG - Intronic
1105680421 13:22720804-22720826 AAAAACTATTAGATCTGGTAAGG + Intergenic
1109899193 13:68741680-68741702 TAGAACAATTTGTTCTACTCTGG - Intergenic
1110107490 13:71696053-71696075 AAAAACAATGAGATCTAGGGAGG + Intronic
1111512203 13:89280919-89280941 AAGAACAATTATAACATGTCAGG - Intergenic
1113012896 13:105791267-105791289 AAGAACAATTACATCTAAGTTGG - Intergenic
1114337383 14:21705172-21705194 AAGAATAAAAAGATGTAGTCTGG + Intergenic
1116242465 14:42362870-42362892 AAGAAAAATTAAAAGTAGTCAGG - Intergenic
1120115141 14:80607655-80607677 AAGAACACTTAGGTCTAGTATGG + Intronic
1134511246 16:14849260-14849282 AACAACAAATAAATCTCGTCAGG - Intronic
1134698889 16:16247756-16247778 AACAACAAATAAATCTCGTCAGG - Intronic
1134972948 16:18546917-18546939 AACAACAAATAAATCTCGTCAGG + Intronic
1137774228 16:51042105-51042127 AAGGACTATTAGATGTTGTCTGG + Intergenic
1139108483 16:63858882-63858904 AGGAAGTATTAGATATAGTCTGG - Intergenic
1143442346 17:6984993-6985015 AAGAACAATTGGCTACAGTCAGG - Intronic
1145230178 17:21168238-21168260 ATGAACAACTTCATCTAGTCAGG + Intronic
1146572284 17:33963081-33963103 AAGAACATTGAGATCTAGAGAGG + Intronic
1153682479 18:7513548-7513570 AAGAACAGTTAATTCTAGTGTGG + Intergenic
1154183983 18:12164812-12164834 AAGAAAAATCAGACCTAGTCTGG - Intergenic
1156745905 18:40390809-40390831 AAGAAGAGTAAGATATAGTCAGG - Intergenic
1157307470 18:46527734-46527756 ATGAACAATTAGATCTCTTGTGG + Intronic
1164039493 19:21482860-21482882 AAGAACAATCATACCCAGTCAGG - Intronic
1164550310 19:29205412-29205434 AAGCACATTTTGATCCAGTCAGG + Exonic
925741942 2:7013127-7013149 AAGAATAATTTGATCTAAACTGG - Intronic
926575336 2:14574637-14574659 AAGAACAATTAAATCAAATGAGG + Intergenic
931372801 2:61679709-61679731 ATGAACAAATAGATATAGTAAGG - Intergenic
933518433 2:83336394-83336416 AAGATAAATTAGATCTATGCAGG - Intergenic
933817284 2:86078336-86078358 AAGAAAAATTAAATCAAGCCAGG - Intronic
939692408 2:145280679-145280701 AAGAGCAATTGGAGCTGGTCCGG + Intergenic
941332639 2:164197555-164197577 AAGAACAGTAAGTTCTATTCAGG - Intergenic
944008934 2:194947979-194948001 AATAACATATAGAACTAGTCTGG - Intergenic
945547828 2:211179236-211179258 AAGACCAAGTAGATCAAGACTGG + Intergenic
945651054 2:212559787-212559809 AATAACAATTAGATCTGGTGCGG + Intergenic
946011450 2:216567406-216567428 AAGAACATTTAGATTCAGGCTGG + Intronic
946952924 2:224897035-224897057 AAGAACTCTTAGATCATGTCAGG - Intronic
947064722 2:226209803-226209825 AAGAAGAATTATGTCTAGTGTGG + Intergenic
947279196 2:228429037-228429059 AAGAACAATAAATTCTAGTGAGG - Intergenic
949061722 2:241963563-241963585 TAGAACATTAAGATCTAGGCTGG + Intergenic
1168996747 20:2138864-2138886 AATAAAAATTAAATCTAGCCAGG + Intronic
949095359 3:79178-79200 ATGAAAAATTAGGTCTATTCTGG + Intergenic
950058574 3:10049801-10049823 AAGAATAATTAAATTTAGCCTGG + Intronic
951142983 3:19189197-19189219 AAGAACAATTAGATTTTTGCTGG - Intronic
954236994 3:49264557-49264579 AACAAAAATTAAATATAGTCCGG + Intergenic
955596649 3:60597752-60597774 AAGAAGAATTAGGTTTAGTTAGG - Intronic
956223425 3:66928687-66928709 AAAAATTATTAGATCTAGTGAGG + Intergenic
957636890 3:82798115-82798137 AAGGACAACAACATCTAGTCTGG - Intergenic
957744334 3:84318856-84318878 AGGATGAATTAGATTTAGTCTGG - Intergenic
959918629 3:111846611-111846633 ATGAAAAATTAAATCTAGTTTGG - Intronic
961239090 3:125394737-125394759 GAGAACAAATAGATCTGGGCTGG + Intergenic
961802134 3:129459516-129459538 AAAAAAAAATAGATGTAGTCAGG - Intronic
964891598 3:161542916-161542938 AAAAACAATAAGATATATTCTGG + Intergenic
967775648 3:193383303-193383325 AAAAAAAATTATATCTTGTCTGG + Intergenic
968198943 3:196735511-196735533 AAGAACTGTTAGGACTAGTCAGG - Intronic
974873046 4:67667244-67667266 CAAAATAATTAGATATAGTCAGG + Intronic
975192504 4:71481524-71481546 AAGAACAAGTGGATCAAGTATGG - Intronic
976887567 4:90004911-90004933 AAGAACAATGAATTCAAGTCAGG - Intergenic
981319686 4:143377072-143377094 AATAATATTTAGATTTAGTCTGG + Intronic
986672231 5:10152502-10152524 AAGAAAACAGAGATCTAGTCAGG - Intergenic
988664973 5:33316438-33316460 AAGACCAATCAGATCTATTAAGG - Intergenic
989508943 5:42260639-42260661 ATGAACAAGTAGATATAGTTAGG + Intergenic
991437593 5:66612550-66612572 AAGAAATAATAGATCTGGTCAGG + Intronic
994742729 5:103641957-103641979 AGGAACAATGAGATCTAGCAGGG - Intergenic
999382347 5:151130409-151130431 AATAACAAATAGAACTAGCCAGG - Intronic
1000813972 5:165897847-165897869 AAGAACAATAAGAAATAGTTGGG + Intergenic
1002932808 6:1646066-1646088 AAGAACAATTGCATTTAGTTGGG - Intronic
1004333110 6:14739641-14739663 AAGAAAAATGGGATATAGTCAGG + Intergenic
1005376326 6:25186116-25186138 AAGAAAAATAAGAGCTAGTTTGG - Intergenic
1009506737 6:64492655-64492677 AAGAACAATTAACTCTACCCAGG + Intronic
1010409345 6:75543613-75543635 AAGAACAGATAGATATAGGCTGG + Intergenic
1010550940 6:77222022-77222044 ATGAACAATAAGGTCCAGTCGGG + Intergenic
1012431938 6:99172970-99172992 AAGAAAAATTATCTCCAGTCTGG - Intergenic
1013287898 6:108696589-108696611 AAGATCAAATAGATCCAGTCCGG - Intergenic
1013362080 6:109403264-109403286 AAAAAAAATTAGAGCTAGCCAGG - Intronic
1015098540 6:129447287-129447309 AAGAACAATCACCTCTAGTAGGG + Intronic
1015190844 6:130470568-130470590 ATGAACATCAAGATCTAGTCTGG + Intergenic
1015363265 6:132366424-132366446 AAAAACAATGAGAACTAGACGGG + Intronic
1017241252 6:152171551-152171573 AAGAAGAATCTGATCTAATCTGG + Intronic
1017755881 6:157528767-157528789 AAGCACAATTAGATGAAGACTGG + Intronic
1017755887 6:157528823-157528845 AAGCACAATTAGATGAAGACTGG + Intronic
1017755895 6:157528879-157528901 AAGCACAATTAGATGAAGACTGG + Intronic
1018362170 6:163082018-163082040 AAAAACAATTAGATCCAGTAAGG + Intronic
1029469296 7:100744011-100744033 AAGAACAAAGAGATATAGGCTGG - Intronic
1031808465 7:126336373-126336395 AATAACAATTAGATAGAGGCGGG - Intergenic
1039131925 8:34274806-34274828 AGAAACAATAAGATGTAGTCTGG - Intergenic
1042645631 8:70983247-70983269 AAGAACAAATAGGAATAGTCAGG - Intergenic
1044887877 8:96798740-96798762 AAGAACAATTAAATTTATTTAGG - Intronic
1047872775 8:129103517-129103539 AAGAATAGTTAAATCTAGTGAGG + Intergenic
1048366304 8:133741847-133741869 AAGAACAATTAGATCTAATATGG + Intergenic
1051547529 9:18293083-18293105 AAGAAGAATAAGATCATGTCTGG - Intergenic
1051890423 9:21936896-21936918 AAGAATAATTTGGTCTAGTTTGG + Intronic
1054830912 9:69623572-69623594 AAGAACAATTAGATCTAGTCAGG - Intronic
1057773706 9:97987953-97987975 AAGAAAAATTAGATATAGATAGG + Intronic
1059562835 9:115351788-115351810 AACCACAATCTGATCTAGTCTGG - Intronic
1060743767 9:126116641-126116663 ATGAACAAGTAGATTTAGCCTGG - Intergenic
1187679126 X:21749053-21749075 AAGAACAATGACAACTAGTGGGG + Intronic
1196475932 X:116086165-116086187 AAGAACAATTATATCTATTTGGG - Intergenic
1197864287 X:131001222-131001244 AAATACAATTAGAACCAGTCAGG + Intergenic
1198023329 X:132680652-132680674 AGGAGAAACTAGATCTAGTCTGG + Intronic
1200323518 X:155214693-155214715 AAGACCAATCATATTTAGTCAGG + Intronic