ID: 1054840118

View in Genome Browser
Species Human (GRCh38)
Location 9:69729459-69729481
Sequence CTGTAGCCCTTCAATAATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054840118 Original CRISPR CTGTAGCCCTTCAATAATGA GGG (reversed) Intronic
909126451 1:71677141-71677163 TTGTTGGCCTTCTATAATGATGG + Intronic
910049489 1:82958135-82958157 CTGTAGCCCAGGAATAATCAGGG - Intergenic
910613254 1:89167610-89167632 CTGGAGTCCCTCATTAATGATGG - Intronic
913520856 1:119644970-119644992 CTGTTTCCATTCAATTATGAAGG - Intronic
919988774 1:202694346-202694368 CTTTTTCCCTTCAATATTGAGGG + Intronic
921668063 1:217896151-217896173 CTGCATCCTTTCAATAATGTGGG + Intergenic
923962877 1:239104156-239104178 CTGTAGCCCAGGAATAATCAGGG - Intergenic
1066437112 10:35405434-35405456 CTGTAGCCCAGGAATAATCAGGG + Intronic
1074647379 10:115474197-115474219 ATGTTGCCCTTCAGAAATGAAGG - Intronic
1078428636 11:11270573-11270595 CTGCAGCCCTTCATTCCTGAGGG - Intergenic
1081319192 11:41669272-41669294 CTGTAGCATTTCAGTACTGATGG - Intergenic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1082686957 11:56250681-56250703 CTGTAGTCCCTCATTTATGAGGG + Intergenic
1086550308 11:88045976-88045998 CTGTAGCCCAGGAATAATCAGGG - Intergenic
1087167979 11:95023417-95023439 CTGTAGCCCAGGAATAGTGAAGG + Intergenic
1088779065 11:113116327-113116349 CTCTTTCCCTTCTATAATGAAGG - Intronic
1092170722 12:6372441-6372463 CAGCAGCCCTTCAAGAAGGAGGG + Intronic
1098446999 12:70576292-70576314 CTGTAGCAATTCTGTAATGATGG - Intronic
1101438455 12:104684209-104684231 CTGTAATCCTTCAAGAAGGAAGG - Intronic
1104213405 12:126712408-126712430 CTGCAGCCCTTCAATGAAAAGGG - Intergenic
1107122180 13:36807955-36807977 CTGGACCCCATCAATAATAACGG + Intergenic
1107981882 13:45741840-45741862 ATGTTTCTCTTCAATAATGAAGG - Intergenic
1113612731 13:111659047-111659069 CTGGCGCCCCTCAGTAATGAAGG - Intronic
1120348284 14:83318701-83318723 CTGTAGCCCTAAATTAATGCTGG - Intergenic
1123935461 15:25191942-25191964 CTGCAGCCCTGCAGTGATGACGG + Intergenic
1123937265 15:25200004-25200026 CTGGAGCCCTGCAGTGATGACGG + Intergenic
1126791585 15:52226501-52226523 CTGGAGCCCTTAAATACTCAGGG - Intronic
1126998907 15:54479148-54479170 CTGCAGTGCTTCAATAATCACGG + Intronic
1128555990 15:68631995-68632017 CTGTTGACCTTTAGTAATGAGGG + Intronic
1129179591 15:73865601-73865623 ATGTAACCCTGCAATAATGGGGG + Intergenic
1129376559 15:75137425-75137447 CTGCAGCCCTTCACTAATCATGG - Intergenic
1133202305 16:4211402-4211424 CTGTTGTCCTTCAATGATGATGG + Intronic
1138765128 16:59592802-59592824 CTGCAGGTCTTGAATAATGATGG - Intergenic
1139213418 16:65103406-65103428 CTGTAACACCTTAATAATGATGG - Intronic
1145319898 17:21759375-21759397 CTTTACCCCTTTAATAATGTGGG - Intergenic
1145407604 17:22619031-22619053 CTGTAGCTCTCAAATACTGATGG + Intergenic
1146267955 17:31465480-31465502 CTGCAGCCCCTCAATACGGATGG + Intronic
1149173658 17:53843895-53843917 CTGGAGCCCTTCAAGAAACAAGG + Intergenic
1152866375 17:82726216-82726238 CTGTAGCCTTCCAAGAATGAAGG - Intronic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1154427530 18:14283655-14283677 CTGTAGCTTTTCAACACTGAGGG - Intergenic
1154430258 18:14303195-14303217 CTGTAGCTTTTCAACACTGAGGG - Intergenic
1160859736 19:1232643-1232665 CAGTAGCCCTTCAATTCTGCAGG - Intronic
1162465890 19:10840031-10840053 CTTTAGCCATTCATTATTGAGGG + Intronic
1163209750 19:15831600-15831622 CTGTAGCCCAGCAATAGTCAGGG - Intergenic
1163394059 19:17048772-17048794 CTGGAGCCCTTTAATATTGAGGG - Intergenic
1165136924 19:33675360-33675382 CTGTAGCCATTGAACCATGAAGG + Intronic
931514191 2:63033099-63033121 CTGGAGTCCTGCAATAATGTTGG + Intronic
931710243 2:64983256-64983278 CTATAGCCATTCTTTAATGAGGG + Intergenic
934491983 2:94767767-94767789 CTGTAGCTTTTCCATACTGAGGG - Intergenic
934492449 2:94770910-94770932 CTGTAGCTTTTCCATACTGAGGG - Intergenic
934494112 2:94782630-94782652 CTGTAGCTTTTCCATACTGAGGG + Intergenic
934544028 2:95199777-95199799 GTATAGCCCTTCAATAAGGCTGG + Intergenic
935507329 2:103921697-103921719 CAGTAGCCCTTCAATATAGTTGG + Intergenic
939663562 2:144920933-144920955 GTGTGGCCCGTCATTAATGAAGG + Intergenic
940216920 2:151311620-151311642 CTGTAGCCCAGGAATAATCAGGG - Intergenic
942393058 2:175516500-175516522 CTGTAGCCCTCCATTACTGGAGG + Intergenic
942485205 2:176431994-176432016 CTTTAGCCCTTCCTTAAAGAAGG - Intergenic
944617840 2:201481299-201481321 CTGGACCCCCTCAAGAATGAAGG + Intergenic
946721055 2:222608282-222608304 CTGGAGCCCTCAAATAATGGAGG - Intronic
1171032089 20:21685981-21686003 CTGTAACTCATTAATAATGAAGG - Intergenic
1171883258 20:30633139-30633161 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1171885003 20:30645760-30645782 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1173642262 20:44612002-44612024 CTGTATCCATTCAATCATGTTGG + Intronic
1176729064 21:10472019-10472041 CTGTAGTCTTTCAATAAAGTGGG + Intergenic
1176842500 21:13851898-13851920 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1177678857 21:24337949-24337971 CTGTGTCCCTTCATTAAAGAAGG + Intergenic
1178664800 21:34537366-34537388 CTGTAGCCCATTAACATTGACGG + Intronic
1182857843 22:33534092-33534114 CTGCAGGCCTTCACTAAAGAGGG + Intronic
951496533 3:23334382-23334404 CTGTGCCCCATCAATAGTGATGG - Intronic
952052485 3:29401492-29401514 CTGTAGCCCTGCACCAGTGAAGG - Intronic
956428769 3:69163875-69163897 CAGTAGCCCTTCAATTATGATGG - Intergenic
962234145 3:133693410-133693432 TTTCAGCCCTTGAATAATGATGG + Intergenic
963111746 3:141694214-141694236 CTGTAGCCCAGGAATAGTGAGGG + Intergenic
963572166 3:147011557-147011579 CTTTACCTCTTCAATAATAAAGG + Intergenic
965278804 3:166722291-166722313 ATGGAGCCCTTCAATAAACAGGG + Intergenic
965375965 3:167924408-167924430 CTGTAGACCTTCAAAGATCAAGG - Intergenic
966064415 3:175800676-175800698 CAGTAGACCCTCAATAATGTTGG - Intronic
968350502 3:198048443-198048465 CTGTAGCTTTTCCATACTGAGGG - Intergenic
970853960 4:20633212-20633234 CTGTAGCCCAGGAATAATCAGGG + Intergenic
975954948 4:79826155-79826177 CTGTAGCACTTCCTTATTGAGGG + Intergenic
981397275 4:144267708-144267730 TTGTAACACTTTAATAATGAAGG + Intergenic
982606794 4:157525986-157526008 GTGGAGCCCTTCAAGAAGGAAGG + Intergenic
984876002 4:184368130-184368152 CTGGACCCCTTCAATCATGTAGG + Intergenic
991438314 5:66618598-66618620 CTGTCTCCCTTCAATACAGAGGG - Intronic
992884186 5:81141387-81141409 CTGTGCCCCTTCCATAGTGAGGG - Intronic
993680199 5:90868351-90868373 CAGCAGCCTTTCATTAATGAGGG - Intronic
994244579 5:97465761-97465783 CTGGAGCCCTTCAAGAATCAAGG + Intergenic
1003285771 6:4732699-4732721 CAGTATCCCTTCAATTTTGAGGG + Intronic
1004503058 6:16226342-16226364 CTGCAGACCTTCACAAATGAGGG + Intergenic
1006241581 6:32684547-32684569 CTGTAGTCCTCCTCTAATGAAGG - Intergenic
1007184950 6:39962184-39962206 CTGTAGCTGCTTAATAATGAGGG - Intergenic
1007790837 6:44307228-44307250 CTGTAGCCCTTCCAGACTCACGG + Exonic
1010011779 6:71056084-71056106 GTGTATCCCTTCAGTATTGAAGG + Intergenic
1010311211 6:74388206-74388228 CTGCATCCCTTGAATAATTAAGG - Intergenic
1012060275 6:94469568-94469590 CTGTTGCCCTTCAATCCTGATGG + Intergenic
1014213299 6:118729446-118729468 CTGTAGCCCTTCCCTAATTCAGG + Intergenic
1015626995 6:135189628-135189650 CTGTAGCCTGTAAGTAATGAGGG + Intronic
1026573931 7:71556142-71556164 CTGTAGCCCTTAAATACGCAAGG + Intronic
1031355097 7:120780062-120780084 CTGTAGCCCTGGAATAGTCAGGG + Intergenic
1031835356 7:126674929-126674951 CCCTAGCCCTTGAAGAATGAAGG - Intronic
1034600525 7:152249577-152249599 CTGTAGTCTTTCAATAAAGTGGG - Intronic
1036790180 8:11712141-11712163 CTTTAGCCCTTCATAAATGATGG + Intronic
1038032252 8:23652743-23652765 CAGTAGCCATTCAAGAATGGTGG + Intergenic
1041208256 8:55520734-55520756 CTGTAGCCGTAGAAAAATGAAGG - Intronic
1041917447 8:63151253-63151275 CTGTAGCCCAGGAATAATCAGGG + Intergenic
1043717804 8:83508070-83508092 CTGTAGCCCATGAATAGTCAGGG + Intergenic
1044372364 8:91427173-91427195 TTGTAGGCATTCAATAATTATGG + Intergenic
1045015166 8:97995059-97995081 CTGTACCCCTTGAATATTGCTGG - Intronic
1045826412 8:106403477-106403499 GTGGAGCTCTTCAAGAATGATGG + Intronic
1046292351 8:112179741-112179763 CTGGAGCCTTACAATCATGATGG + Intergenic
1047433749 8:124817020-124817042 ATGTATCCCTTAAATGATGAGGG + Intergenic
1051799537 9:20916878-20916900 CTCTAACCCTGCAATAAAGATGG - Exonic
1052878475 9:33585036-33585058 CTGTAGCTTTTCCATACTGAGGG + Intergenic
1053496639 9:38553003-38553025 CTGTAGCTTTTCCATACTGAGGG - Intronic
1053497506 9:38559173-38559195 CTGTAGCTTTTCCATACTGAGGG - Intronic
1053662958 9:40297374-40297396 CTGTAGCTTTTCCATACTGAGGG - Intronic
1053666448 9:40321188-40321210 CTGTAGCTTTTCCATACTGAGGG + Intronic
1053913465 9:42927907-42927929 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1053914193 9:42932689-42932711 CTGTAGCTTTTCCATACTGAGGG + Intergenic
1053916034 9:42946234-42946256 CTGTAGCTTTTCCATACTGAGGG + Intergenic
1054375085 9:64443598-64443620 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1054377600 9:64461216-64461238 CTGTAGCTTTTCCATACTGAGGG + Intergenic
1054518161 9:66055095-66055117 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1054521657 9:66078910-66078932 CTGTAGCTTTTCCATACTGAGGG + Intergenic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1056585854 9:87926679-87926701 CTGTAGCCTTTCCATACTGAGGG - Intergenic
1056611030 9:88126264-88126286 CTGTAGCCTTTCCATACTGAGGG + Intergenic
1057675674 9:97134382-97134404 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1057676555 9:97140564-97140586 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1057677415 9:97146760-97146782 CTGTAGCTTTTCCATACTGAGGG - Intergenic
1203585188 Un_KI270746v1:62055-62077 CTGTAGTCTTTCAATAAAGTGGG - Intergenic
1188505876 X:30884378-30884400 CATTATCCCTTCAAAAATGAGGG + Intronic
1189065457 X:37803686-37803708 TTGTAGCCCATTACTAATGATGG - Intronic
1191588239 X:62852037-62852059 TTGTACCCCTTCCATTATGAAGG + Intergenic
1193071559 X:77311235-77311257 ATGTTACCCTTCAATAATGTAGG + Intergenic
1198456416 X:136822182-136822204 CTGAAGCTTTTCAATAATGCTGG - Intergenic
1198607766 X:138361873-138361895 CCTTAGCCTTTCAATAAAGAGGG - Intergenic
1200861088 Y:7993641-7993663 CTGTAGCACTTCATTAATTAAGG + Intergenic
1201471646 Y:14341571-14341593 CAGTAGCCCTTCAAAATTGGAGG - Intergenic