ID: 1054842662

View in Genome Browser
Species Human (GRCh38)
Location 9:69760012-69760034
Sequence GAGCGCGCGCGCGCGCGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 647
Summary {0: 1, 1: 9, 2: 30, 3: 119, 4: 488}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054842653_1054842662 17 Left 1054842653 9:69759972-69759994 CCGCGTGAGCCGGGCCGCCGGCG 0: 1
1: 0
2: 1
3: 14
4: 119
Right 1054842662 9:69760012-69760034 GAGCGCGCGCGCGCGCGCGCGGG 0: 1
1: 9
2: 30
3: 119
4: 488
1054842651_1054842662 20 Left 1054842651 9:69759969-69759991 CCTCCGCGTGAGCCGGGCCGCCG 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1054842662 9:69760012-69760034 GAGCGCGCGCGCGCGCGCGCGGG 0: 1
1: 9
2: 30
3: 119
4: 488
1054842659_1054842662 0 Left 1054842659 9:69759989-69760011 CCGGCGGGAGTTCCGCGGAGAAC 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1054842662 9:69760012-69760034 GAGCGCGCGCGCGCGCGCGCGGG 0: 1
1: 9
2: 30
3: 119
4: 488
1054842658_1054842662 3 Left 1054842658 9:69759986-69760008 CCGCCGGCGGGAGTTCCGCGGAG 0: 1
1: 0
2: 0
3: 6
4: 46
Right 1054842662 9:69760012-69760034 GAGCGCGCGCGCGCGCGCGCGGG 0: 1
1: 9
2: 30
3: 119
4: 488
1054842656_1054842662 8 Left 1054842656 9:69759981-69760003 CCGGGCCGCCGGCGGGAGTTCCG 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1054842662 9:69760012-69760034 GAGCGCGCGCGCGCGCGCGCGGG 0: 1
1: 9
2: 30
3: 119
4: 488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054842662 Original CRISPR GAGCGCGCGCGCGCGCGCGC GGG Intergenic