ID: 1054843928

View in Genome Browser
Species Human (GRCh38)
Location 9:69772432-69772454
Sequence GACTCCTAGAAACTTCACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054843922_1054843928 17 Left 1054843922 9:69772392-69772414 CCCTTCACCTTGGTAGAAATGTG No data
Right 1054843928 9:69772432-69772454 GACTCCTAGAAACTTCACTAAGG No data
1054843924_1054843928 10 Left 1054843924 9:69772399-69772421 CCTTGGTAGAAATGTGCCATGCC No data
Right 1054843928 9:69772432-69772454 GACTCCTAGAAACTTCACTAAGG No data
1054843923_1054843928 16 Left 1054843923 9:69772393-69772415 CCTTCACCTTGGTAGAAATGTGC No data
Right 1054843928 9:69772432-69772454 GACTCCTAGAAACTTCACTAAGG No data
1054843926_1054843928 -6 Left 1054843926 9:69772415-69772437 CCATGCCTCAACTAATGGACTCC No data
Right 1054843928 9:69772432-69772454 GACTCCTAGAAACTTCACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054843928 Original CRISPR GACTCCTAGAAACTTCACTA AGG Intergenic
No off target data available for this crispr