ID: 1054847109

View in Genome Browser
Species Human (GRCh38)
Location 9:69809236-69809258
Sequence AGTGTAATGAGATCAGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054847109_1054847120 27 Left 1054847109 9:69809236-69809258 CCAGATGCTGATCTCATTACACT No data
Right 1054847120 9:69809286-69809308 CAAGGGGCTTGAGGCAGCCACGG No data
1054847109_1054847114 4 Left 1054847109 9:69809236-69809258 CCAGATGCTGATCTCATTACACT No data
Right 1054847114 9:69809263-69809285 CGGAATGGGTAACCTTCAGGTGG No data
1054847109_1054847117 11 Left 1054847109 9:69809236-69809258 CCAGATGCTGATCTCATTACACT No data
Right 1054847117 9:69809270-69809292 GGTAACCTTCAGGTGGCAAGGGG No data
1054847109_1054847112 -10 Left 1054847109 9:69809236-69809258 CCAGATGCTGATCTCATTACACT No data
Right 1054847112 9:69809249-69809271 TCATTACACTTAGTCGGAATGGG No data
1054847109_1054847116 10 Left 1054847109 9:69809236-69809258 CCAGATGCTGATCTCATTACACT No data
Right 1054847116 9:69809269-69809291 GGGTAACCTTCAGGTGGCAAGGG No data
1054847109_1054847119 18 Left 1054847109 9:69809236-69809258 CCAGATGCTGATCTCATTACACT No data
Right 1054847119 9:69809277-69809299 TTCAGGTGGCAAGGGGCTTGAGG No data
1054847109_1054847113 1 Left 1054847109 9:69809236-69809258 CCAGATGCTGATCTCATTACACT No data
Right 1054847113 9:69809260-69809282 AGTCGGAATGGGTAACCTTCAGG No data
1054847109_1054847115 9 Left 1054847109 9:69809236-69809258 CCAGATGCTGATCTCATTACACT No data
Right 1054847115 9:69809268-69809290 TGGGTAACCTTCAGGTGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054847109 Original CRISPR AGTGTAATGAGATCAGCATC TGG (reversed) Intergenic
No off target data available for this crispr