ID: 1054847250

View in Genome Browser
Species Human (GRCh38)
Location 9:69810199-69810221
Sequence GAGGCTCGGCACTGGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054847242_1054847250 1 Left 1054847242 9:69810175-69810197 CCACTTCAGAATTGGGGAACTGA No data
Right 1054847250 9:69810199-69810221 GAGGCTCGGCACTGGGGAGGAGG No data
1054847238_1054847250 14 Left 1054847238 9:69810162-69810184 CCTTGGATGGGAGCCACTTCAGA No data
Right 1054847250 9:69810199-69810221 GAGGCTCGGCACTGGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054847250 Original CRISPR GAGGCTCGGCACTGGGGAGG AGG Intergenic
No off target data available for this crispr