ID: 1054849021

View in Genome Browser
Species Human (GRCh38)
Location 9:69827541-69827563
Sequence GTACACATACAGATGGTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 88}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054849021_1054849033 14 Left 1054849021 9:69827541-69827563 CCCACTACCATCTGTATGTGTAC 0: 1
1: 0
2: 1
3: 8
4: 88
Right 1054849033 9:69827578-69827600 ATGTGACATTTTGGTGGGGGTGG No data
1054849021_1054849034 17 Left 1054849021 9:69827541-69827563 CCCACTACCATCTGTATGTGTAC 0: 1
1: 0
2: 1
3: 8
4: 88
Right 1054849034 9:69827581-69827603 TGACATTTTGGTGGGGGTGGAGG No data
1054849021_1054849030 9 Left 1054849021 9:69827541-69827563 CCCACTACCATCTGTATGTGTAC 0: 1
1: 0
2: 1
3: 8
4: 88
Right 1054849030 9:69827573-69827595 AGGTTATGTGACATTTTGGTGGG No data
1054849021_1054849031 10 Left 1054849021 9:69827541-69827563 CCCACTACCATCTGTATGTGTAC 0: 1
1: 0
2: 1
3: 8
4: 88
Right 1054849031 9:69827574-69827596 GGTTATGTGACATTTTGGTGGGG No data
1054849021_1054849032 11 Left 1054849021 9:69827541-69827563 CCCACTACCATCTGTATGTGTAC 0: 1
1: 0
2: 1
3: 8
4: 88
Right 1054849032 9:69827575-69827597 GTTATGTGACATTTTGGTGGGGG No data
1054849021_1054849029 8 Left 1054849021 9:69827541-69827563 CCCACTACCATCTGTATGTGTAC 0: 1
1: 0
2: 1
3: 8
4: 88
Right 1054849029 9:69827572-69827594 GAGGTTATGTGACATTTTGGTGG No data
1054849021_1054849028 5 Left 1054849021 9:69827541-69827563 CCCACTACCATCTGTATGTGTAC 0: 1
1: 0
2: 1
3: 8
4: 88
Right 1054849028 9:69827569-69827591 GCTGAGGTTATGTGACATTTTGG No data
1054849021_1054849035 24 Left 1054849021 9:69827541-69827563 CCCACTACCATCTGTATGTGTAC 0: 1
1: 0
2: 1
3: 8
4: 88
Right 1054849035 9:69827588-69827610 TTGGTGGGGGTGGAGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054849021 Original CRISPR GTACACATACAGATGGTAGT GGG (reversed) Intronic
903174795 1:21574512-21574534 GTATACATACCGATGTTAGCAGG - Intronic
906109297 1:43312515-43312537 CTGCACATCCAGCTGGTAGTGGG - Exonic
909416282 1:75409311-75409333 GTACACCTACAGAATGTATTGGG + Intronic
911657333 1:100460055-100460077 GTACACATACAGCTAGTAAGAGG - Intronic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
922562842 1:226581642-226581664 GTACACACAGAGATGATGGTGGG + Intronic
923416821 1:233770511-233770533 ATACACATCCAGAAGGTACTAGG + Intergenic
1066175920 10:32905785-32905807 GTGCAGATAAAGATGGTATTGGG - Intronic
1068320596 10:55409182-55409204 ATACACATAGAGATGTGAGTGGG - Intronic
1068364253 10:56024999-56025021 ATACACATACATATGTGAGTTGG - Intergenic
1069724087 10:70566355-70566377 CTACACATACAGAAAGTACTGGG - Intronic
1078558810 11:12353195-12353217 ATACACATGCAGATGGCAGGTGG + Intronic
1078858338 11:15224799-15224821 GTACAATTACAGATGGTAAATGG + Intronic
1079928761 11:26530910-26530932 GGATACATAAAGATGGTGGTAGG - Intronic
1080934089 11:36843436-36843458 ATACACATAAAGATGATGGTGGG + Intergenic
1082838933 11:57672759-57672781 GTACACATGCAAATGGTTGCAGG - Exonic
1084962420 11:72724187-72724209 GCACCCATACAGATGGGTGTGGG - Intronic
1085968161 11:81554255-81554277 GTACATATAAAGATTGTTGTAGG - Intergenic
1090383888 11:126345414-126345436 GTGCACATGCAGGTGGTAGTAGG - Exonic
1097073573 12:56375306-56375328 GTACACTTAGAAATGGTTGTGGG + Intergenic
1101800866 12:108020973-108020995 GTACACATACAGAGGATGGGTGG + Intergenic
1102225209 12:111223751-111223773 GTTCACAGTCAGATGGCAGTTGG - Intronic
1106795440 13:33200336-33200358 TTCCACATACAGATGGTGGGTGG - Intronic
1109334346 13:60974008-60974030 TTACACACACAGATTGTACTTGG - Intergenic
1109490310 13:63088950-63088972 ATTCACATACAGAAGGTATTTGG + Intergenic
1117243780 14:53862721-53862743 GTAACCATGCAGATGGGAGTGGG + Intergenic
1119026047 14:71153256-71153278 GTACACATACAGGTGGTGATAGG + Intergenic
1120647044 14:87086723-87086745 ATACTCATACAGGTGGTGGTTGG + Intergenic
1120772334 14:88393997-88394019 GTACAGAAACAGGTGGTAGGAGG - Intronic
1121092400 14:91191676-91191698 GTACAGATACAGAGGGCAGGGGG + Intronic
1124794562 15:32764380-32764402 GTACTAAAACAGATGTTAGTTGG + Intergenic
1125495959 15:40194011-40194033 GAAGACATATAGATGGAAGTTGG - Intronic
1126648782 15:50901139-50901161 GGTCACATACAGAAAGTAGTTGG + Intergenic
1149291834 17:55225180-55225202 GTTCAGATAGAGATGGTAGGAGG - Intergenic
1149596394 17:57867127-57867149 GTACACATCTAGGTGGAAGTAGG + Intronic
1151141210 17:71993654-71993676 GTGCACTTGCAGATGGTGGTGGG - Intergenic
1156445024 18:37230235-37230257 GTACAAACACAGAGGGCAGTGGG - Intronic
925421395 2:3715688-3715710 GTACACATACACATATTATTTGG - Intronic
928111651 2:28515322-28515344 CTGCACAGACAGATGGTAGCTGG - Intronic
928994196 2:37269347-37269369 TCACACATACAGATGTTTGTCGG - Intronic
940366451 2:152853412-152853434 GGACACAGACATATGGGAGTGGG - Intergenic
940686956 2:156863738-156863760 ATACACATATATATGATAGTGGG + Intergenic
941545611 2:166846860-166846882 GTACAGCTACAGATTGTAATGGG - Intergenic
941842232 2:170098621-170098643 GAGCACATACAGAGAGTAGTGGG - Intergenic
942082917 2:172418346-172418368 GTACATATCCAGATGGTAAGAGG - Intergenic
943361611 2:186925647-186925669 GTACAGAGACAGAAGGAAGTGGG + Intergenic
943576341 2:189635425-189635447 ATACAAATCCAGAGGGTAGTTGG - Intergenic
944430933 2:199632997-199633019 ATACAAATACAGCTGGTACTTGG + Intergenic
944485269 2:200199009-200199031 GAAGACATACAAATGGTAATAGG + Intergenic
948044468 2:234932888-234932910 GTAAACAGACAAATGGAAGTGGG + Intergenic
1169465533 20:5835023-5835045 GAACACATTCAGATGATAGCAGG + Intronic
1172277685 20:33688923-33688945 GTACACATCCAGGTAGAAGTAGG + Intergenic
1173153846 20:40591098-40591120 GTACACAAAGAGATGTTATTAGG - Intergenic
1174654629 20:52160385-52160407 ATACACACACAGATGGCAGCAGG + Intronic
1175347676 20:58293176-58293198 GTACACCTACAGGTGGTTTTAGG - Intergenic
1180218103 21:46339250-46339272 GTAGACATATAGTTGGCAGTTGG + Intronic
1184350740 22:43942178-43942200 GCACACACCCAGATGGAAGTGGG - Intronic
949376886 3:3400691-3400713 GTACACACACTGATTGTGGTTGG + Intergenic
953575391 3:44109295-44109317 GTACACATATAGCAGGCAGTGGG - Intergenic
953888718 3:46734830-46734852 TTACACAAACAGATGGTTGGGGG + Intronic
955720873 3:61879818-61879840 ATATACATACAGATAGTAGAAGG - Intronic
958612605 3:96446760-96446782 GAACACATACACATGGAAGTTGG - Intergenic
961352656 3:126313916-126313938 TTACACAAACAGATGGTAGACGG - Intergenic
962105433 3:132383807-132383829 GGACACCTAGTGATGGTAGTGGG - Intergenic
963030143 3:140962376-140962398 GTTAACATAGAGGTGGTAGTGGG + Intronic
966262477 3:177995808-177995830 GAATACATACAGATGATAGTAGG - Intergenic
970665396 4:18330662-18330684 GTACAAACCCAGATGGCAGTTGG - Intergenic
977370181 4:96125621-96125643 GTATACATACACATAGCAGTGGG - Intergenic
984498726 4:180531917-180531939 GTAAAAATACAGATGGAATTTGG - Intergenic
988070270 5:26278949-26278971 GTAAATATACAGATCCTAGTGGG + Intergenic
990981768 5:61607746-61607768 GTACATACAGAGATGGTGGTAGG - Intergenic
991204587 5:64035873-64035895 GCACACATACACATAGTATTCGG + Intergenic
991274734 5:64831331-64831353 GTATATATACACATGGTGGTGGG - Intronic
992809820 5:80375480-80375502 GTAAACATACAGAAGCTAGCTGG - Intergenic
992920481 5:81511508-81511530 TAATACATACAGAAGGTAGTGGG - Intronic
999538441 5:152545059-152545081 GTACACTTACAAATGGTAATGGG + Intergenic
1003461339 6:6331386-6331408 GTTGAAATAAAGATGGTAGTTGG - Intergenic
1003727952 6:8787409-8787431 ATACACATAAAGATGGGAGTAGG + Intergenic
1018425713 6:163678827-163678849 TGCCACATAAAGATGGTAGTGGG + Intergenic
1024344278 7:48297057-48297079 ATTCACATACAGATGGTATTGGG + Intronic
1025968369 7:66297265-66297287 GGACACATACAGAAGACAGTTGG - Intronic
1029504269 7:100952743-100952765 GTAGACCTGCTGATGGTAGTGGG - Exonic
1031294415 7:119983685-119983707 GTACACATAAAGTTGCTTGTGGG + Intergenic
1032207403 7:129879771-129879793 GTACACCTATTGATTGTAGTAGG - Intronic
1032366380 7:131304023-131304045 GTACACATACAGCACATAGTAGG - Intronic
1032740685 7:134735554-134735576 ACACACACACAGAGGGTAGTGGG - Intergenic
1036103800 8:5817875-5817897 GTACACACACAAATGGAAATGGG + Intergenic
1052080345 9:24198344-24198366 GTAGGCATATAGTTGGTAGTGGG + Intergenic
1053651746 9:40176577-40176599 AGACACATACAGATGATATTTGG - Intergenic
1053902136 9:42805899-42805921 GGACACATACAGATGGTATTTGG - Intergenic
1054532840 9:66199626-66199648 GGACACGTACAGATGATATTTGG + Intergenic
1054849021 9:69827541-69827563 GTACACATACAGATGGTAGTGGG - Intronic
1054974261 9:71123586-71123608 GCATGCATACATATGGTAGTAGG + Intronic
1055475162 9:76656150-76656172 GTGCTAATACAGATGGTTGTGGG - Intronic
1060534157 9:124369884-124369906 GTACCCATACAGTGGGCAGTAGG - Intronic
1185777753 X:2819117-2819139 GTACACATAAAAATGGATGTTGG + Intergenic
1198254533 X:134913921-134913943 TTACACTTATAGTTGGTAGTGGG - Intronic
1198812506 X:140549841-140549863 ATTCACATACAGAGTGTAGTTGG - Intergenic