ID: 1054851586

View in Genome Browser
Species Human (GRCh38)
Location 9:69852188-69852210
Sequence GCAGAAAAGCTACAGTTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054851582_1054851586 11 Left 1054851582 9:69852154-69852176 CCTTTGTATATATTTTTTTTTTT 0: 1
1: 7
2: 209
3: 2369
4: 41815
Right 1054851586 9:69852188-69852210 GCAGAAAAGCTACAGTTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054851586 Original CRISPR GCAGAAAAGCTACAGTTGGT AGG Intronic
No off target data available for this crispr