ID: 1054854840

View in Genome Browser
Species Human (GRCh38)
Location 9:69887802-69887824
Sequence CTGGTGGCTCAGAGCTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 129}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054854840_1054854852 26 Left 1054854840 9:69887802-69887824 CCTTTTAAGCTCTGAGCCACCAG 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1054854852 9:69887851-69887873 AGAGGCCGTGGGAGGAACACTGG No data
1054854840_1054854849 14 Left 1054854840 9:69887802-69887824 CCTTTTAAGCTCTGAGCCACCAG 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1054854849 9:69887839-69887861 TCTGTTGGAGGGAGAGGCCGTGG No data
1054854840_1054854845 2 Left 1054854840 9:69887802-69887824 CCTTTTAAGCTCTGAGCCACCAG 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1054854845 9:69887827-69887849 AATCCAGGCTACTCTGTTGGAGG No data
1054854840_1054854851 18 Left 1054854840 9:69887802-69887824 CCTTTTAAGCTCTGAGCCACCAG 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1054854851 9:69887843-69887865 TTGGAGGGAGAGGCCGTGGGAGG No data
1054854840_1054854844 -1 Left 1054854840 9:69887802-69887824 CCTTTTAAGCTCTGAGCCACCAG 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1054854844 9:69887824-69887846 GAGAATCCAGGCTACTCTGTTGG No data
1054854840_1054854848 8 Left 1054854840 9:69887802-69887824 CCTTTTAAGCTCTGAGCCACCAG 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1054854848 9:69887833-69887855 GGCTACTCTGTTGGAGGGAGAGG No data
1054854840_1054854850 15 Left 1054854840 9:69887802-69887824 CCTTTTAAGCTCTGAGCCACCAG 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1054854850 9:69887840-69887862 CTGTTGGAGGGAGAGGCCGTGGG No data
1054854840_1054854846 3 Left 1054854840 9:69887802-69887824 CCTTTTAAGCTCTGAGCCACCAG 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1054854846 9:69887828-69887850 ATCCAGGCTACTCTGTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054854840 Original CRISPR CTGGTGGCTCAGAGCTTAAA AGG (reversed) Intronic
910275439 1:85444704-85444726 CTGGAGGCTCAGAAGTGAAAAGG + Intronic
913524653 1:119679285-119679307 AGGGTGGCACAGAGCTTCAATGG + Intronic
913658589 1:120985491-120985513 CTTCTGGCTCAGATGTTAAATGG + Intergenic
914009953 1:143768616-143768638 CTTCTGGCTCAGATGTTAAATGG + Intergenic
914648573 1:149677272-149677294 CTTCTGGCTCAGATGTTAAATGG + Intergenic
916337777 1:163692637-163692659 CGGGTGGCTCTCAGCTGAAAGGG + Intergenic
923030883 1:230248285-230248307 CTGATGGCAGAGAGCTTAAGAGG + Intronic
923305633 1:232685681-232685703 CTGGTGGCAAGGAGCTTATAAGG + Intergenic
1064074827 10:12260367-12260389 CTGCTAGCTCAGAGCTCATAAGG - Intergenic
1066379558 10:34889747-34889769 CTGGTGGCTGATATTTTAAATGG - Intergenic
1067243810 10:44519060-44519082 CTGGTGGCTCAGTCCCCAAAAGG + Intergenic
1071325238 10:84509015-84509037 TTGGTGGCTAAGATTTTAAAAGG + Intronic
1074071700 10:110077146-110077168 CTGATTGCTCACAGCTTAAGGGG + Intronic
1074632351 10:115272672-115272694 ATGCTGACTCAGAGCTTATATGG + Intronic
1075706488 10:124505021-124505043 CTGGTGGCTCCGAGCATATGTGG + Intronic
1075731888 10:124641278-124641300 CTGGGGGCTCAGAGTTAAACTGG - Intronic
1076625187 10:131817434-131817456 GTGGTGACTCAGAGCTGAAGGGG + Intergenic
1081775774 11:45675108-45675130 CAGCTGGCTCAGAGCTAGAATGG + Intergenic
1085653120 11:78286485-78286507 CAGGATGCTCAGAACTTAAAGGG - Intronic
1087611095 11:100434873-100434895 CTTATGTCTCAGAGCTTAAATGG - Intergenic
1089685741 11:120145621-120145643 CAGGAGGCCCAGAGCTTACATGG + Intronic
1090261657 11:125325329-125325351 CTGGAAGCTCAGAGCTTAGTGGG + Intronic
1090998403 11:131887727-131887749 CTGGTGGCTCATAACTTAATGGG - Intronic
1091779332 12:3204126-3204148 CTTGTGGCTCAGATCCAAAAAGG + Intronic
1094433857 12:30399389-30399411 CTGGTGGATCAGAGATAAAAGGG + Intergenic
1097748806 12:63329839-63329861 CTCTAGGCTCAGAGCTTAGAAGG - Intergenic
1100386697 12:94110445-94110467 CTGGTGGCCCAGATCCTAATAGG - Intergenic
1106722845 13:32453808-32453830 CTGGTGACTCTGAGCTCAAAGGG + Intronic
1111343753 13:86922854-86922876 CTGGAGCCTCAGAGCTTAGATGG - Intergenic
1113382506 13:109816947-109816969 CTGGTGCCTCAGAGATTCAGTGG + Intergenic
1113398538 13:109970942-109970964 CTGGTGGCACAGCACTGAAAAGG + Intergenic
1116276664 14:42842537-42842559 CTTGTGTTTCAGATCTTAAAGGG + Intergenic
1117536423 14:56707358-56707380 ATGGTGGCTCAAAGGTTTAAAGG + Intronic
1117717862 14:58599297-58599319 TTGGTGGCCCACAGATTAAAAGG + Intergenic
1118772503 14:68951627-68951649 CTGGAGTTTCAGAGCTGAAAGGG - Intronic
1120920313 14:89749071-89749093 CTGGTGACTCAGGGCTCCAAAGG + Intergenic
1122817971 14:104323198-104323220 CTGGTGGCTCAGCGGCTGAAGGG + Intergenic
1125761464 15:42098797-42098819 CTGGCGGCTCAGGGCTCTAAGGG - Intergenic
1129658510 15:77540425-77540447 CTGGTGGCTCAGGGATCCAAGGG - Intergenic
1130043951 15:80429848-80429870 CTGGTGGTACAGAGCTTAGTTGG - Intronic
1130484520 15:84391197-84391219 CTGTTAGCTCAGAGATTTAAAGG + Intergenic
1130834517 15:87636125-87636147 ATGGAGGCTCAGAGCTCCAAAGG + Intergenic
1131899823 15:97075366-97075388 CTGGTGGCTCAGCCATTTAAGGG - Intergenic
1132030795 15:98437359-98437381 CAGGTGGCACAGACCATAAAAGG - Exonic
1135465780 16:22683639-22683661 CTGGTGGCTGGGAGATGAAATGG + Intergenic
1137984163 16:53093863-53093885 CTGGTGGGTCAGAGCTCTCAAGG - Intronic
1138262158 16:55631536-55631558 CTGGTGGCTTTGAGCTGAAGGGG + Intergenic
1141286904 16:82681123-82681145 CTGGTGTCTGAAAGATTAAAGGG + Intronic
1144311138 17:14015379-14015401 CTGGAGGCTCAGGGTTTCAATGG - Intergenic
1147158084 17:38554913-38554935 CTGATGACACAGAGCTTTAAGGG - Intronic
1149584979 17:57780377-57780399 CTGGTGGGTAGGGGCTTAAAGGG + Intergenic
1153431767 18:5025110-5025132 CGGGTGCCTGAGAGGTTAAAGGG + Intergenic
1154437480 18:14357841-14357863 CTGGTGGCTCAGTCCTGCAAAGG + Intergenic
1156779867 18:40838164-40838186 CAGGTGGGTCTGAGCTTCAAAGG + Intergenic
1156877940 18:42038817-42038839 CTGGTGGCTAACACCTTATAAGG - Exonic
1157672579 18:49542740-49542762 CTCGTGGTTCAAAACTTAAAAGG + Intergenic
1158135283 18:54201210-54201232 CAGGTTTCTCAGACCTTAAAGGG - Intronic
1161829971 19:6595615-6595637 CTGGAGGCTAGGAGCTGAAATGG + Intronic
1164731870 19:30511757-30511779 GGGGTGGCTCAGAGCTTACATGG + Intronic
926207043 2:10841213-10841235 CTGGTGGCTGAGTGCTACAAAGG + Intergenic
926924003 2:17968470-17968492 CTTGTGGCTCACAGCTTTAATGG + Intronic
927920986 2:26971359-26971381 CTGGCTGCTCAGAGCTTGCAGGG + Intronic
935549152 2:104433310-104433332 CTGCCTCCTCAGAGCTTAAATGG + Intergenic
940174839 2:150866716-150866738 CTGGTGGCTCACAGATCCAAAGG + Intergenic
941644142 2:168022351-168022373 ATGGTGGGTAAGAGCATAAATGG - Intronic
942268485 2:174250431-174250453 ATACTGGCTCAGAGCTTATAGGG - Intergenic
942814340 2:180034158-180034180 CTGGTTGCTCAGTGCTGGAATGG + Intergenic
944397761 2:199288927-199288949 CTGGTGGCTTAGCTCTTAAAAGG + Intronic
944457497 2:199910940-199910962 CTGGTCTTTCAGGGCTTAAAAGG - Intergenic
946763433 2:223018432-223018454 GTGGTTGCTCAGAGCTTCAAAGG - Intergenic
946769066 2:223069659-223069681 CTGGGAGCGCAGAGCTTATAAGG + Intronic
1171172235 20:23025851-23025873 CTGGGGCCTGATAGCTTAAAGGG - Intergenic
1175735260 20:61381640-61381662 CTGGTGGCTCAAATCTTCCAAGG - Intronic
1178713414 21:34941208-34941230 CTGGAGGCACAGAGGCTAAAGGG - Intronic
1179054825 21:37921723-37921745 CTGGGAGCTCTGAGCTAAAATGG + Intergenic
1181099649 22:20530794-20530816 CAGGTGACTCAGAGCTCCAATGG + Intronic
1181524144 22:23469479-23469501 CTGTTGACTCCTAGCTTAAAGGG - Intergenic
1183221133 22:36514120-36514142 TTGGAGGCTCAGAGCTTAGGTGG + Intronic
1184292806 22:43507128-43507150 CTGGGGGCTCACAGCACAAAAGG + Exonic
1184874194 22:47262651-47262673 CAGGAGTCTCAGAGCTTCAAGGG + Intergenic
951571328 3:24066227-24066249 GTTGTGGCTCAGAGATTAAGGGG - Intergenic
952983270 3:38755669-38755691 CTGGAGGCATAGAGCCTAAAAGG - Intronic
954301548 3:49703215-49703237 CTGCTGGCTCTGACCTGAAATGG + Intronic
955899886 3:63741256-63741278 CTGGTGTCTCTGAGCTGAAAAGG + Intergenic
956260074 3:67329647-67329669 CTGCTGTCTCAAAGCTTGAAGGG - Intergenic
957450808 3:80379667-80379689 CTGAAGCCTCAGAGTTTAAAGGG - Intergenic
960149156 3:114232814-114232836 CTGGTGCCTCTGAGCTTCACAGG - Intergenic
960329399 3:116339693-116339715 CTGGTGGCTCAAAGCTCTGAAGG - Intronic
961509669 3:127393182-127393204 GTGGTGGCTCAGGGCTTCTAGGG - Intergenic
964406845 3:156358153-156358175 ATGGTGGCTCAAAGATGAAAAGG - Intronic
965926636 3:173988514-173988536 CAGGTTGCTCAGACCTTAACAGG + Intronic
966200046 3:177352696-177352718 CTGGTGGCTCAGAGCCCATGTGG - Intergenic
967270496 3:187728647-187728669 CTGGGGTCTCAGAGCTTGAGTGG - Intronic
972436933 4:39044419-39044441 CTGTTGTCTCAGAGCTTAAAGGG - Intergenic
978994724 4:115136471-115136493 CTGATGGCTAAGAACTCAAAAGG + Intergenic
979573241 4:122254814-122254836 CTGGTGTTGCAGTGCTTAAAAGG - Exonic
980969858 4:139557602-139557624 CTTTTGGCTCTGTGCTTAAATGG + Intronic
982037137 4:151356770-151356792 CTGCTGGGTCAGAGCTGAAGAGG + Intergenic
992432950 5:76727408-76727430 CTGGAGGTTCAGAGATTAACAGG + Intronic
993222510 5:85118465-85118487 CTGTTGTCTAAGAGCTTGAATGG + Intergenic
1000197708 5:158975739-158975761 CTGGGGGGTCAGAGCTGGAAGGG + Intronic
1001040604 5:168332230-168332252 CTGATGACTCAGAGCTGAGAAGG + Intronic
1005429488 6:25740089-25740111 CTGTTGCCTCATAGCTAAAAGGG - Intergenic
1007461988 6:42025706-42025728 CTTGTGACTCAGAGCCCAAAAGG - Intronic
1007630119 6:43268755-43268777 CTGGTGGCTCAGACTTTGAGGGG + Intronic
1008938718 6:57021453-57021475 CTGGTGGCTTAGATTTAAAAGGG + Intronic
1014298457 6:119649946-119649968 CAGCTGGATCAGAGCATAAATGG + Intergenic
1014805067 6:125820254-125820276 CTTGTGGGTCAGAGGTTCAAGGG - Intronic
1018663550 6:166112770-166112792 CGGGTGACTCATAGCTTACACGG + Intergenic
1019567047 7:1689355-1689377 CTGAGGGCTCAGAGCTCAGATGG + Intronic
1026272647 7:68850091-68850113 GTGGTGTCTCAGAGCTGAGAGGG - Intergenic
1026518412 7:71093422-71093444 CTAGGAGCTCAGAGTTTAAATGG + Intergenic
1028466745 7:91160998-91161020 CTGGGAGCTCAGAGTTTAATTGG + Intronic
1031067534 7:117121607-117121629 CTGGTGGCTCTCTCCTTAAAGGG + Intronic
1034184781 7:149166981-149167003 ATGGTGGCTCAGAGCTAAGCAGG + Intronic
1034386239 7:150743491-150743513 CTGGTGGCTCAGGGCTCAGGGGG - Exonic
1034540716 7:151756290-151756312 CTGGTGGCTCCTACGTTAAAAGG - Intronic
1034731758 7:153393003-153393025 CTGATGGCTCTGAGCTGAAAGGG + Intergenic
1037002925 8:13742932-13742954 GTGGTGGCTTAGACTTTAAAAGG + Intergenic
1037093045 8:14946506-14946528 CTGGTGGTTCATAACTTAGAGGG - Intronic
1038938962 8:32282708-32282730 CAGGTGGGTCAGATCTTTAAGGG - Intronic
1041547849 8:59066718-59066740 CTGGGGCCTCCGAGTTTAAATGG - Intronic
1042737610 8:72005920-72005942 CTGGGAGATCAGAGCTGAAAAGG - Intronic
1045456878 8:102389303-102389325 ATGGTAGCTCAGAGTTTCAAAGG - Intronic
1046056064 8:109080607-109080629 CTGGTACCCCTGAGCTTAAAAGG + Intergenic
1047151780 8:122272187-122272209 TTTGTGAATCAGAGCTTAAAGGG - Intergenic
1049092798 8:140529411-140529433 CTGATGATTCAGAGTTTAAATGG - Intergenic
1050479831 9:6078204-6078226 CTGGAGGCTCAGACATTTAAAGG - Intergenic
1054854840 9:69887802-69887824 CTGGTGGCTCAGAGCTTAAAAGG - Intronic
1056332392 9:85531999-85532021 CCGGAGGCTCAGAGCTGAGAGGG - Intergenic
1060282284 9:122222671-122222693 CTGGTGGCTCAGGGAATTAAAGG - Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1061530388 9:131207409-131207431 CTGTTGGCTCAGACCTTAGCTGG + Intronic
1061996887 9:134190720-134190742 CAGGTGGCTCGGAGCTGAACTGG - Intergenic
1203361464 Un_KI270442v1:221323-221345 CTGGTCTCCCAGAGCTTGAACGG - Intergenic
1187308742 X:18120920-18120942 CAGGTGGCTCACAGCTGAATAGG - Intergenic
1189355828 X:40309284-40309306 ATGGTAGCTCAGAGCTCCAAAGG - Intergenic
1192204429 X:69086619-69086641 CTTGTGGCCCAAAGCTAAAAGGG + Intergenic
1196318990 X:114266544-114266566 CTGGAGGCTGAGAGCTACAATGG + Intergenic
1198273605 X:135079792-135079814 ATTGTGGCTCAGAGGTTAAATGG - Intergenic
1198684168 X:139210153-139210175 CTGGAGGCTCACAGCTTGAATGG - Intronic
1199258337 X:145743301-145743323 CAAGTGCCTCAGAGCCTAAAAGG + Intergenic
1201852283 Y:18498599-18498621 CTGGTGGCTCACACCTCCAATGG + Intergenic
1201881038 Y:18821785-18821807 CTGGTGGCTCACACCTCCAATGG - Intronic