ID: 1054855440

View in Genome Browser
Species Human (GRCh38)
Location 9:69894270-69894292
Sequence CAGATCCTAAGGTTGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054855440_1054855444 15 Left 1054855440 9:69894270-69894292 CCCAGCTTCAACCTTAGGATCTG 0: 1
1: 0
2: 1
3: 8
4: 134
Right 1054855444 9:69894308-69894330 ATAACTCCATAGAACTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054855440 Original CRISPR CAGATCCTAAGGTTGAAGCT GGG (reversed) Intronic
901420003 1:9144473-9144495 CAGATACTCAGGGTGAAGCGGGG + Intergenic
901672058 1:10861822-10861844 CAGAGCTTAGGGTTGAAGGTGGG + Intergenic
904340225 1:29829536-29829558 CAGGTCCTAAGGTGGAACCAGGG - Intergenic
907704706 1:56822427-56822449 CAGATACTTAGGCTGAAGTTTGG + Intergenic
908387927 1:63660006-63660028 CACATCCTAAGGATGAAGAATGG - Exonic
909220141 1:72948000-72948022 CACATCCTAAATTTGAAGCCAGG - Intergenic
909987621 1:82182128-82182150 CAGAACCTAAGCTTGAAAGTTGG + Intergenic
910201939 1:84708776-84708798 CAGAACCTAAGGATGACCCTAGG - Intergenic
910342861 1:86207974-86207996 CAGATAATATGGATGAAGCTGGG + Intergenic
913547730 1:119886102-119886124 CAGAGTCTAGGGTTGCAGCTAGG + Intergenic
917403928 1:174683158-174683180 AAGATTCTAAGGTTGAAGTGTGG - Intronic
920535642 1:206734860-206734882 CAGAGCCTAAAGTAGAAACTGGG + Intergenic
920924771 1:210330662-210330684 CAGGTCCTAAGCTGGAAGCAGGG - Intronic
921678650 1:218006095-218006117 CAGGTGCTAAGGGTGAAGGTAGG - Intergenic
922366418 1:224868701-224868723 CAGATCTAAAGGATGAAGATGGG + Intergenic
1062865529 10:849292-849314 CTGATTCTAAGGCTGAAGCAAGG + Intronic
1063551676 10:7039751-7039773 CAGGTCCTAAGCTAGATGCTGGG + Intergenic
1063711567 10:8483874-8483896 CAGATCCTAGGATTTAAGATGGG - Intergenic
1064873088 10:19962264-19962286 CAGATCCTCTGTTTGAAACTAGG + Intronic
1065822786 10:29541401-29541423 CAGATTTTAAGGATGCAGCTTGG - Intronic
1069606645 10:69743113-69743135 GAGATCCTAAGGTTATGGCTGGG - Intergenic
1072605535 10:96979004-96979026 CAGAGCCAAAGGTGGAATCTCGG + Intronic
1074206592 10:111288055-111288077 CAGATCTGTAGGTTTAAGCTTGG - Intergenic
1074442209 10:113487945-113487967 CAGAAGCTATGGTAGAAGCTGGG - Intergenic
1076306102 10:129466861-129466883 CAGAGCCTCAGGCGGAAGCTGGG + Intergenic
1077366394 11:2162980-2163002 CAGCCCCTGAGGTTGCAGCTGGG - Intergenic
1081703195 11:45164659-45164681 CAGATCCTGAGGCTGGAACTTGG + Intronic
1083506534 11:63163136-63163158 CAGATCCTAGGCTGGGAGCTTGG - Intronic
1084652241 11:70496003-70496025 CAGAGGCTAAGGTGGCAGCTGGG + Intronic
1086159755 11:83708783-83708805 CAGATACTAAGGAAGAAACTGGG + Intronic
1090142149 11:124276984-124277006 CAGTCCCTAAGGCTGAAGCGAGG + Intergenic
1096300954 12:50426841-50426863 CAGATGCTGAGGTTGAAGAATGG - Intronic
1097102918 12:56601945-56601967 CTGAGCCTCAGGCTGAAGCTGGG + Exonic
1097236014 12:57540097-57540119 CAGATCCTGTGGTCGAGGCTGGG + Intronic
1097870806 12:64600539-64600561 AAGATCCAAATGTTGAAGTTTGG + Intergenic
1099137296 12:78922342-78922364 CAAAGCCTAGGGTTGAAGCGAGG - Intronic
1099406987 12:82276144-82276166 CTAATCCTCAGGTTGTAGCTTGG - Intronic
1102485071 12:113249969-113249991 CACCTCCTAAGGTTGATGCGAGG + Intronic
1107349106 13:39495726-39495748 CAGATACCAACCTTGAAGCTGGG + Intronic
1107448907 13:40491292-40491314 CAGATCCTAAGGCAGCCGCTTGG - Intergenic
1108148295 13:47502613-47502635 CAGACCCCAAGGTAGAAGCTGGG + Intergenic
1111381223 13:87455451-87455473 CAGATTCTAAGGTTCTAACTTGG - Intergenic
1115128993 14:30031091-30031113 CAGATCCAATGGTAGAAGGTAGG - Intronic
1115287459 14:31731566-31731588 CAGATCCTAAGATAGATGCCAGG + Intronic
1115614245 14:35078191-35078213 CAGATCCAAAGTTCAAAGCTAGG - Intronic
1117847327 14:59925002-59925024 CAGATGATAAGGTGGAATCTGGG - Intronic
1120761471 14:88289328-88289350 CAGTTCCTCAGGCTGAAGCAGGG + Intronic
1121952653 14:98185127-98185149 CAGAGTCCATGGTTGAAGCTGGG - Intergenic
1122107839 14:99472160-99472182 CAGTTCCCAAGGATGAGGCTGGG + Intronic
1123501837 15:20893311-20893333 AAGATCCTTAGGTAGAGGCTGGG + Intergenic
1123559090 15:21467010-21467032 AAGATCCTTAGGTAGAGGCTGGG + Intergenic
1123595321 15:21904291-21904313 AAGATCCTTAGGTAGAGGCTGGG + Intergenic
1124163307 15:27294643-27294665 CAGATTCTCAGGCTGTAGCTGGG + Intronic
1124461063 15:29892267-29892289 CAGATGAAAAGTTTGAAGCTAGG + Intronic
1202967439 15_KI270727v1_random:194169-194191 AAGATCCTTAGGTAGAGGCTGGG + Intergenic
1136010673 16:27361583-27361605 GGGATCCTAGGGTTGAAGCAGGG - Intronic
1140351813 16:74269691-74269713 GAAATCCTAATGTTCAAGCTTGG - Intergenic
1140657197 16:77152927-77152949 CAGGTCCTACGCTAGAAGCTGGG - Intergenic
1142949946 17:3470815-3470837 CACATCTTAGGCTTGAAGCTGGG + Intronic
1143263865 17:5621125-5621147 CAGCTCCTCAGGCTTAAGCTGGG - Intergenic
1144292417 17:13839251-13839273 AAGATCCTCAGGTTAAAGGTTGG + Intergenic
1146223595 17:31047741-31047763 CAGATCCAAAGGTTGAACTGTGG + Intergenic
1146961108 17:36980302-36980324 CAGATGCTAAGGTTGAATCTTGG + Intronic
1148174010 17:45548689-45548711 CAGATCCAAAGGTTGAACTGTGG + Intergenic
1148275257 17:46296758-46296780 CAGATCCAAAGGTTGAACTGTGG - Exonic
1148297363 17:46514337-46514359 CAGATCCAAAGGTTGAACTGTGG - Exonic
1148361917 17:47018817-47018839 CAGATCCAAAGGTTGAACTGCGG - Intronic
1150405224 17:64895611-64895633 CAGATCCAAAGGTTGAACTGTGG + Exonic
1152132562 17:78485842-78485864 CAGGTCCTAATGTTGAAAATCGG + Intronic
1163280878 19:16316859-16316881 CAGATTCTGAGGTTGTAGCCAGG - Intergenic
1166597636 19:44063947-44063969 AAGTTCCAAAGGTTGAAACTTGG - Intronic
1167074170 19:47238994-47239016 CAGATGCTCATGTTGAGGCTGGG + Intergenic
1168470093 19:56632811-56632833 CAGCTCCTAAGGTTGATGTAAGG + Intergenic
926045167 2:9704702-9704724 CAGGGCCTGAGGTTGGAGCTGGG - Intergenic
929793901 2:45043715-45043737 GAAATACTGAGGTTGAAGCTGGG - Intergenic
930676692 2:54209045-54209067 CAGTTCTTAAGAATGAAGCTAGG + Intronic
931019912 2:58032480-58032502 CAGATCATAAGGGTGGAGCAGGG - Intronic
931598526 2:63977308-63977330 AACTTCCTAAGGTAGAAGCTTGG + Intronic
931879771 2:66556338-66556360 TAGATCCTATGGTTGAAGAAGGG + Intronic
936432789 2:112479690-112479712 CAAATTCTAAGGTCTAAGCTAGG + Intergenic
937815479 2:126245827-126245849 TAGATGCTTAGATTGAAGCTTGG - Intergenic
947919429 2:233856355-233856377 CAGAGCCTAAAGTGGAAACTTGG + Intergenic
1171005991 20:21466288-21466310 CAGATTCTAAGTCTCAAGCTGGG - Intergenic
1171967515 20:31541838-31541860 CAGATCCAAAGGTTTAAGACAGG + Intronic
1174584801 20:51600093-51600115 CAGATCCCAACGCTGTAGCTTGG + Exonic
1177096912 21:16847300-16847322 CAAATCATAAGATGGAAGCTTGG - Intergenic
1178048726 21:28725304-28725326 CAGATTCTGAGATAGAAGCTGGG + Intergenic
1178510168 21:33198448-33198470 CAGAGCCCAAGGATGAAGCTTGG + Intergenic
1179680302 21:43015984-43016006 AAGATCTTAAGGTGGAAGCTGGG + Intronic
1181612776 22:24029898-24029920 CAGAACCCAAGTTTTAAGCTGGG - Intronic
1182473011 22:30560265-30560287 CAGAGCCTGAGGTTGGTGCTGGG - Intronic
952432344 3:33235888-33235910 CATAGCCTAGGGATGAAGCTAGG + Intergenic
953635925 3:44664119-44664141 TAGAGCCTAAAGTTGAATCTGGG + Intergenic
961673667 3:128551888-128551910 CAGACCCTAAGGCAGAGGCTGGG + Intergenic
967165089 3:186773170-186773192 CAGAACATAAGGTTGTGGCTGGG - Intergenic
970604432 4:17666111-17666133 CAGAGCCTAAGCTTTAAGCCAGG - Intronic
971187939 4:24399166-24399188 CAGATAGGAAGGTGGAAGCTTGG - Intergenic
971231729 4:24805583-24805605 CAGTTCTTAAGGGTGAATCTTGG + Intergenic
972684262 4:41336342-41336364 CAGATCCTAAGCTCCAAGATTGG - Intergenic
974223645 4:59009700-59009722 CAGTTCTGAAGGTTGTAGCTTGG + Intergenic
979252970 4:118584722-118584744 CAGATCTTAAGGAGGAAGCGAGG - Intergenic
981825564 4:148936838-148936860 CTGATTCTAAGGCTGGAGCTGGG - Intergenic
986888462 5:12270061-12270083 CAGGTCCTAATGTGGCAGCTTGG - Intergenic
990624115 5:57592588-57592610 CAGATTCTAAAGTGGAAGCTAGG + Intergenic
990758506 5:59102527-59102549 CAGATCCTGAGGTTGGAACCTGG - Intronic
992220196 5:74564308-74564330 CAGATCCTCAGGTAGAAACTTGG + Intergenic
994268241 5:97743531-97743553 CAGAGCCTATTGTTGAATCTAGG + Intergenic
994724749 5:103421276-103421298 CAGAACCGTAGGTTGAACCTTGG - Intergenic
996587600 5:125107954-125107976 CAGCTCCCAAGGTTCAAGATTGG - Intergenic
997591697 5:135077123-135077145 CACATCCCATTGTTGAAGCTAGG + Intronic
1000435043 5:161197574-161197596 CTGATCCTCAGGTTGCAGGTGGG - Intergenic
1004745151 6:18502044-18502066 CAAAGTCCAAGGTTGAAGCTGGG + Intergenic
1011641982 6:89424289-89424311 CAGATACTAAGGATGGAGTTAGG - Intergenic
1012894143 6:104929565-104929587 CAGAACTTAAGGTTGACTCTTGG + Intergenic
1016427442 6:143949464-143949486 CAGGTCCTGAGAGTGAAGCTAGG - Intronic
1017602732 6:156101181-156101203 ATGATGCTAAGGTTGAAGCAAGG - Intergenic
1020224647 7:6271192-6271214 CAGTTCTTATAGTTGAAGCTAGG - Intronic
1020820554 7:12962117-12962139 CAGATCACAAGGCTAAAGCTAGG - Intergenic
1020856812 7:13437325-13437347 AAGATTCTAAGGTAGAAGGTGGG - Intergenic
1022719186 7:32927344-32927366 AAGGTCTTAAGTTTGAAGCTTGG + Intergenic
1024931501 7:54669284-54669306 CACATTCTAAGCATGAAGCTGGG + Intergenic
1026079161 7:67201901-67201923 CACAGCCTAACGTTGAAACTGGG + Intronic
1026697662 7:72610055-72610077 CACAGCCTAACGTTGAAACTGGG - Intronic
1028534025 7:91871310-91871332 CAGATCATAGGATTGTAGCTGGG - Intronic
1032374491 7:131397287-131397309 CAGATGCTAAAGTTAAAGCTGGG - Exonic
1032622502 7:133550733-133550755 CAGGTTCTAATGTGGAAGCTAGG - Intronic
1032724801 7:134580774-134580796 CACATCCTCTGGTTGAGGCTGGG + Intergenic
1033205827 7:139421268-139421290 CAGATCCTAATTTTGAATATGGG + Intronic
1034325152 7:150223452-150223474 TAGATCCTAAGGTAGATGCAGGG + Intergenic
1034768053 7:153745796-153745818 TAGATCCTAAGGTAGATGCAGGG - Intergenic
1037194955 8:16177637-16177659 CAGAACCTAATATTGTAGCTGGG + Intronic
1042738306 8:72013330-72013352 CAGTTCCTAAGTGTGGAGCTGGG + Intronic
1043815317 8:84794019-84794041 GAGATGGTGAGGTTGAAGCTGGG + Intronic
1047911911 8:129539447-129539469 CAGATCCTTAGCTGGGAGCTAGG - Intergenic
1048254076 8:132892050-132892072 CAGATCAGGAGGCTGAAGCTCGG + Intronic
1051021368 9:12547644-12547666 CAAATCCTAAGATTCAGGCTAGG + Intergenic
1054855440 9:69894270-69894292 CAGATCCTAAGGTTGAAGCTGGG - Intronic
1057046923 9:91893199-91893221 CAGAACCCCAGGCTGAAGCTGGG + Intronic
1058936737 9:109776626-109776648 CACATCCTGTGGTAGAAGCTGGG - Intronic
1061855084 9:133437661-133437683 CAGATGCAAAGGATGAAGCTGGG + Intronic
1203561200 Un_KI270744v1:59998-60020 CAGAGCCTCAGCTTGAAGCCGGG - Intergenic
1195375520 X:104223636-104223658 CAGATCCATAGCTTGAAGCATGG - Intergenic
1197976413 X:132170451-132170473 CAGATGCAGAGGTTGAAGCTGGG - Intergenic
1200093603 X:153647195-153647217 CAGTTTCCAAGGTGGAAGCTGGG + Exonic