ID: 1054859241

View in Genome Browser
Species Human (GRCh38)
Location 9:69932291-69932313
Sequence CCTTAGATGTAGAGGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054859226_1054859241 26 Left 1054859226 9:69932242-69932264 CCCCATTCTTGTGGCACCTCCTT No data
Right 1054859241 9:69932291-69932313 CCTTAGATGTAGAGGGAAATGGG No data
1054859234_1054859241 7 Left 1054859234 9:69932261-69932283 CCTTTAAGGGGAAGAGAGTTGGG No data
Right 1054859241 9:69932291-69932313 CCTTAGATGTAGAGGGAAATGGG No data
1054859227_1054859241 25 Left 1054859227 9:69932243-69932265 CCCATTCTTGTGGCACCTCCTTT No data
Right 1054859241 9:69932291-69932313 CCTTAGATGTAGAGGGAAATGGG No data
1054859232_1054859241 10 Left 1054859232 9:69932258-69932280 CCTCCTTTAAGGGGAAGAGAGTT No data
Right 1054859241 9:69932291-69932313 CCTTAGATGTAGAGGGAAATGGG No data
1054859228_1054859241 24 Left 1054859228 9:69932244-69932266 CCATTCTTGTGGCACCTCCTTTA No data
Right 1054859241 9:69932291-69932313 CCTTAGATGTAGAGGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054859241 Original CRISPR CCTTAGATGTAGAGGGAAAT GGG Intergenic
No off target data available for this crispr