ID: 1054864449

View in Genome Browser
Species Human (GRCh38)
Location 9:69985568-69985590
Sequence TGGTAGCCTTAGAAGAGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054864449_1054864451 0 Left 1054864449 9:69985568-69985590 CCTCTACTCTTCTAAGGCTACCA No data
Right 1054864451 9:69985591-69985613 TTATCATTATCTAATTCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054864449 Original CRISPR TGGTAGCCTTAGAAGAGTAG AGG (reversed) Intergenic
No off target data available for this crispr