ID: 1054864671

View in Genome Browser
Species Human (GRCh38)
Location 9:69987852-69987874
Sequence ATTGATATGCATATTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054864671_1054864677 -10 Left 1054864671 9:69987852-69987874 CCCTCCCCAATATGCATATCAAT No data
Right 1054864677 9:69987865-69987887 GCATATCAATCCCCTGGAACTGG No data
1054864671_1054864678 -9 Left 1054864671 9:69987852-69987874 CCCTCCCCAATATGCATATCAAT No data
Right 1054864678 9:69987866-69987888 CATATCAATCCCCTGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054864671 Original CRISPR ATTGATATGCATATTGGGGA GGG (reversed) Intergenic
No off target data available for this crispr