ID: 1054865332

View in Genome Browser
Species Human (GRCh38)
Location 9:69994485-69994507
Sequence GAGGCTAAACAACTTGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054865328_1054865332 2 Left 1054865328 9:69994460-69994482 CCAGCTGAGGACAGTCGGACCCA No data
Right 1054865332 9:69994485-69994507 GAGGCTAAACAACTTGATCATGG No data
1054865325_1054865332 19 Left 1054865325 9:69994443-69994465 CCTTAGCTTTCTATTTTCCAGCT No data
Right 1054865332 9:69994485-69994507 GAGGCTAAACAACTTGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054865332 Original CRISPR GAGGCTAAACAACTTGATCA TGG Intergenic
No off target data available for this crispr