ID: 1054873660

View in Genome Browser
Species Human (GRCh38)
Location 9:70073239-70073261
Sequence CTGAAAATACGTGGTTTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054873658_1054873660 -9 Left 1054873658 9:70073225-70073247 CCAAGCTTAAATATCTGAAAATA 0: 1
1: 0
2: 4
3: 41
4: 421
Right 1054873660 9:70073239-70073261 CTGAAAATACGTGGTTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054873660 Original CRISPR CTGAAAATACGTGGTTTAAA AGG Intronic
No off target data available for this crispr