ID: 1054882847

View in Genome Browser
Species Human (GRCh38)
Location 9:70163164-70163186
Sequence GAGCAGAAATGCAAGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 447}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054882847_1054882850 -2 Left 1054882847 9:70163164-70163186 CCATCTGCCTTGCATTTCTGCTC 0: 1
1: 0
2: 3
3: 41
4: 447
Right 1054882850 9:70163185-70163207 TCCTTTACCTTTTGTTTCCAGGG No data
1054882847_1054882853 5 Left 1054882847 9:70163164-70163186 CCATCTGCCTTGCATTTCTGCTC 0: 1
1: 0
2: 3
3: 41
4: 447
Right 1054882853 9:70163192-70163214 CCTTTTGTTTCCAGGGCTTCAGG No data
1054882847_1054882849 -3 Left 1054882847 9:70163164-70163186 CCATCTGCCTTGCATTTCTGCTC 0: 1
1: 0
2: 3
3: 41
4: 447
Right 1054882849 9:70163184-70163206 CTCCTTTACCTTTTGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054882847 Original CRISPR GAGCAGAAATGCAAGGCAGA TGG (reversed) Intronic
900652319 1:3735754-3735776 GCTCAGAGAGGCAAGGCAGAAGG + Exonic
901814774 1:11787888-11787910 GAGCTGGAAGGCAGGGCAGAGGG - Exonic
902571592 1:17350630-17350652 CTGCAGAAATCCAAGGCTGAAGG + Intronic
903561592 1:24232075-24232097 GAGCAGACATTCCAGGTAGAGGG + Intergenic
903931179 1:26863408-26863430 GAGCAGAAAAGCAACGAGGAGGG + Exonic
905295805 1:36953751-36953773 AAGCAGAGATGCAGGGCAGGTGG + Intronic
905361319 1:37422867-37422889 GAGCACAAATGCCTGGCTGAAGG - Intergenic
906119834 1:43382065-43382087 GAGCAGATAGGAAAGGCAGATGG + Intergenic
908011686 1:59785214-59785236 GGACAGAAAAGCAAGGCAAATGG - Intergenic
908049658 1:60215053-60215075 GAGCAGAAATGAAAAGCCTAAGG + Intergenic
908159005 1:61387577-61387599 GTGCAGACATGAAAGGCAGCAGG - Intronic
908642724 1:66243229-66243251 CAGCAGAAACACAAGGCAGTGGG + Intronic
910086245 1:83406075-83406097 AAGCTGAAATCAAAGGCAGAAGG - Intergenic
910268248 1:85364248-85364270 GTACAGAATTGGAAGGCAGAAGG - Intronic
910380416 1:86621253-86621275 GAGCAGAAGCTCAAAGCAGAGGG + Intergenic
911824842 1:102469372-102469394 GAGCAGAAGAGGAAGGCAGATGG + Intergenic
912723537 1:112039968-112039990 GAGCAGATTTGTATGGCAGAGGG - Intergenic
913492254 1:119391912-119391934 AAGCAGAAAGTCAAGGCAGGAGG + Intronic
914384453 1:147154327-147154349 GAGTGGAAATGCAAGACAGCAGG - Intergenic
914404391 1:147356716-147356738 GAGAAGACATTCAAGGAAGAAGG + Intergenic
914926808 1:151895897-151895919 GAGCAAGAGTGCAAGGCACAAGG - Intronic
915529313 1:156494274-156494296 AAGTAGAAATGCACGGCAGGCGG - Intronic
915651254 1:157312561-157312583 AAACACAAATGCAAGGCACATGG - Intergenic
915858559 1:159418173-159418195 GAGGAGAAATTCAAGCCAGCTGG + Intergenic
916168144 1:161981445-161981467 GAGCAGAAACGGAAGGCAGAGGG - Intergenic
916455984 1:164971422-164971444 CAGCAGAGCTGCAGGGCAGAAGG + Intergenic
917654745 1:177115007-177115029 GAGGAGAAATGAGAGGTAGAAGG + Intronic
918366205 1:183810496-183810518 GAGTTGAAATGCAAGATAGATGG + Intronic
919168850 1:193928692-193928714 GAGCAGAAATGAAAAGAAGTGGG + Intergenic
919532758 1:198745362-198745384 GAGTAGAAATGCAAGTCGGTTGG + Intronic
919551159 1:198989749-198989771 GAGGAGAAATGCCAAGCAAAAGG + Intergenic
919757197 1:201073568-201073590 GAGCAGAAACCCAAGGGTGAGGG - Exonic
920716270 1:208343147-208343169 GAGCAGAATTGTAATGCAGTAGG + Intergenic
921082312 1:211751844-211751866 GGGCAGAAATGAAGGGAAGAGGG - Intronic
921163532 1:212489553-212489575 GAGCAGAAATGCCACACAGGGGG + Intergenic
921608480 1:217182573-217182595 GAGCAAAAATGGAAGAGAGAAGG + Intergenic
922580697 1:226695729-226695751 CAGCAGAATTGGAAGACAGATGG + Intronic
922609304 1:226912737-226912759 CAGGAGAAATTCAAGGCAAATGG - Intronic
922893440 1:229079975-229079997 AATCAGAATCGCAAGGCAGATGG - Intergenic
922948569 1:229538369-229538391 GAACAGAAAGGCCAGGGAGAGGG + Intronic
923159816 1:231306360-231306382 GAGTAGGAAAGTAAGGCAGAAGG - Intergenic
923269417 1:232341539-232341561 GAGCAGATATGCCAGGAAAAGGG - Intergenic
924506117 1:244685915-244685937 GGACAGAAATGCCAGGAAGAGGG - Intronic
924940810 1:248811589-248811611 GAGCAGAAAGGGAAAGCAAAGGG + Exonic
1062988138 10:1789305-1789327 GAACAGAAAATAAAGGCAGAAGG - Intergenic
1063842956 10:10092308-10092330 GAAAAGAAATTCCAGGCAGAGGG - Intergenic
1064650136 10:17500616-17500638 ATGCAGCAATGCAAGGCATAAGG - Intergenic
1064795636 10:19008413-19008435 GAGCAGCAATGCAGGACTGAGGG - Intergenic
1064812565 10:19217092-19217114 GAGCAGCAAGGCCAGACAGAGGG - Intronic
1065251921 10:23823947-23823969 GAACTGAAAAGAAAGGCAGAGGG + Intronic
1065746075 10:28843614-28843636 GGGCAGAAATGGAAGAGAGAAGG - Intergenic
1065903523 10:30228628-30228650 GTGCAGAAATGGAGGGCAAATGG - Intergenic
1066343671 10:34561336-34561358 GAGCAAAAATTCAAAGCAGTTGG - Intronic
1067668391 10:48298420-48298442 GAGGAGATATGCCAGGCAGTAGG - Intergenic
1067676477 10:48383918-48383940 GAGCTGAAATCCAAGGAAGAAGG + Intronic
1068120531 10:52779134-52779156 GAGCAGCAAAGGAAGGCAGAGGG + Intergenic
1068409431 10:56635805-56635827 GATCCTAAATGCAAGGCATAAGG - Intergenic
1068484240 10:57636170-57636192 GAGGAGGAATGCAAGAGAGAAGG + Intergenic
1068722037 10:60256084-60256106 AAGCAGAAAGGCAAAGCTGAAGG - Intronic
1068726740 10:60311631-60311653 GAGCATAAATTAGAGGCAGAGGG - Intronic
1070286349 10:75086673-75086695 GATCAGATATGCAAGGGAGCGGG - Intergenic
1070394207 10:75997936-75997958 AAGCAAACATGCCAGGCAGATGG - Intronic
1071048264 10:81412037-81412059 AGGCAGAAATGGAAGACAGAAGG + Intergenic
1071103597 10:82067986-82068008 GAGGAGGAATGTAAGTCAGAAGG - Intronic
1071747904 10:88442729-88442751 GAGGAGAAGTCAAAGGCAGAGGG - Intronic
1072037893 10:91580992-91581014 GAGGAGGAATCCAAGGCACAAGG + Intergenic
1073945254 10:108742913-108742935 GGGCAGCAATGAAAGGTAGATGG + Intergenic
1073991712 10:109268883-109268905 TAGGAGAAAGGCAAGGCACAAGG + Intergenic
1074608662 10:115000058-115000080 GAAAAGGAAAGCAAGGCAGAGGG + Intergenic
1075300840 10:121322831-121322853 CTGCAGAAAACCAAGGCAGAGGG - Intergenic
1075385012 10:122049257-122049279 AAGCCGAGATGCCAGGCAGAGGG - Intronic
1075396059 10:122128028-122128050 GCAGAGAACTGCAAGGCAGAAGG + Intronic
1076088060 10:127653356-127653378 GAGCAAGAAAGCCAGGCAGAAGG - Intergenic
1076255149 10:129017323-129017345 GTGGAGTAATGCAAGTCAGATGG - Intergenic
1076463765 10:130664572-130664594 GAGCAGAAGTGCAGGGCACTGGG - Intergenic
1076721557 10:132395588-132395610 GAGGAAAAATGCCAGGCAGCAGG - Intergenic
1077553309 11:3213786-3213808 CAGCAGCAATGCAGGGAAGAGGG - Intergenic
1078570589 11:12454169-12454191 GAGCAGATATGAAGGGAAGAAGG + Intronic
1079105380 11:17568865-17568887 GAGCAGAGATGGAACCCAGATGG - Intronic
1079999473 11:27331345-27331367 GAGTATAAAGGTAAGGCAGAAGG - Intronic
1080021455 11:27564709-27564731 GAACAGAAATGCAAAGCAGTAGG + Intergenic
1080309605 11:30874465-30874487 GAGGAGAAAAGCCAGGAAGACGG + Intronic
1080614339 11:33932961-33932983 GAGAGGAAATGGAGGGCAGAGGG - Intergenic
1080919662 11:36696378-36696400 GAGCAGATATTCTAGGCACAGGG + Intergenic
1081553904 11:44139924-44139946 GAAGAAAAATGCCAGGCAGAAGG + Intronic
1081744434 11:45463112-45463134 GAGCCGAAATGCCAGCCAGTTGG + Intergenic
1082727320 11:56751671-56751693 CATCAGAAATGCAAGTCAGCAGG + Intergenic
1083578164 11:63807457-63807479 GAGCAGGTATGCAAGGCAGAAGG + Intergenic
1083723904 11:64618587-64618609 GAGCAGTAAAGCAGGGCAGGGGG + Intronic
1083895953 11:65619812-65619834 GAGGCGAAATGCAGCGCAGAGGG - Exonic
1084146470 11:67267518-67267540 GAGGAGAAATGTAGGGGAGAGGG - Intronic
1084212899 11:67632022-67632044 AAGAAGAAATTCCAGGCAGAGGG - Intronic
1085006453 11:73095609-73095631 GAGGAGAAAGGTAAGGCATAAGG + Intronic
1085753953 11:79188597-79188619 GAGGAGAAAAGCAAAGAAGAAGG + Intronic
1085847787 11:80085476-80085498 CATCAGAAAAGCAAGGGAGATGG - Intergenic
1086351462 11:85946016-85946038 GAGCAGAAGTGAGAGACAGAAGG + Intergenic
1087200919 11:95343699-95343721 GAGCTGCCATGCACGGCAGAAGG + Intergenic
1087697085 11:101391894-101391916 GCCCGGAAATGCAGGGCAGATGG - Intergenic
1088348523 11:108858152-108858174 GAGAAGATATCCTAGGCAGAGGG - Intronic
1089694184 11:120206527-120206549 GGGCAGAAAAACCAGGCAGAAGG - Intergenic
1090382177 11:126335162-126335184 GAGGGGAAGTGCAAGGCAGCAGG + Intronic
1090423630 11:126592392-126592414 GAGGAGAAAAGCAAGGCCAAGGG + Intronic
1090440323 11:126719967-126719989 GAGCTGAAATCAGAGGCAGAGGG - Intronic
1090628527 11:128626620-128626642 GAAGAGAAATGTTAGGCAGAAGG + Intergenic
1091060716 11:132459100-132459122 GAACAGAACAGAAAGGCAGAGGG + Intronic
1092080245 12:5710023-5710045 GAGGAGAAATGCTAGCCAGGAGG + Intronic
1092088088 12:5781726-5781748 CTGCATAAATGCAAGGCAGCAGG + Intronic
1092168058 12:6355126-6355148 GAGCAGGAATGAGGGGCAGAGGG - Intronic
1092471095 12:8781967-8781989 GGACAGAAATGAAAGGCATATGG + Intronic
1093744384 12:22722917-22722939 GAGCAAAAATGGAAAACAGAGGG + Intergenic
1094763551 12:33563291-33563313 GAGCAGATATGCAAATGAGAAGG + Intergenic
1095727446 12:45469274-45469296 GAGCAGAGAGGCCAGGCAGTGGG - Intergenic
1097037249 12:56131979-56132001 GAGCAGGAAGGGAATGCAGAGGG + Intronic
1097181028 12:57171994-57172016 GGGCAGGAATGCAGGTCAGAGGG - Intronic
1097271698 12:57779210-57779232 GGGGAGAAATGCAAGTTAGAGGG - Intronic
1097342637 12:58456379-58456401 GAGCAGAAAGGCAATGGAGCTGG + Intergenic
1097672207 12:62554040-62554062 GAACTGAAATACAAGACAGAAGG - Intronic
1098850848 12:75594259-75594281 GAGGAGAAAGGCAATGGAGAGGG - Intergenic
1102759845 12:115375603-115375625 GAGAAGAAATGAAAGGGAGGGGG + Intergenic
1103738105 12:123073315-123073337 GGACACAGATGCAAGGCAGATGG - Intronic
1104590974 12:130084474-130084496 CAGGAGAAATGCACAGCAGAAGG + Intergenic
1105421322 13:20254897-20254919 GAGCAGAAATAGAAGGGAGTAGG - Intergenic
1107733223 13:43369688-43369710 GAGGAGAAATTCAAGACAGGAGG - Intronic
1108421588 13:50255745-50255767 GAGCAGAGGTGCAAGGCCAATGG - Intronic
1108590024 13:51905170-51905192 GAGAAGAAATGTCAGGCTGAAGG + Intergenic
1108975523 13:56438929-56438951 GAGCAGAAACTTAAGGCAGCTGG + Intergenic
1109609657 13:64747307-64747329 GAAAAGAAATTCAAGGCATATGG - Intergenic
1109619218 13:64879837-64879859 GAGCAGCAGGGCAAGGAAGAAGG - Intergenic
1110714288 13:78683855-78683877 CAGCAGAACAGCATGGCAGAGGG + Intergenic
1111509006 13:89235904-89235926 CAGCAGAAAAGCAAGGGAGGGGG - Intergenic
1111996789 13:95173416-95173438 GAGCAGAAGAGAAAGGCAGGAGG + Intronic
1112162320 13:96881168-96881190 GAGCTGAGATGCAGAGCAGAGGG - Intergenic
1112192149 13:97188436-97188458 GAACAGAAATGCAGGGGAAAAGG - Intergenic
1112467334 13:99655482-99655504 GGACAGAAATGCAAGTCAGTGGG + Intronic
1113159259 13:107361449-107361471 GAGAAGACATTCAAGGCAAAAGG + Intronic
1113883734 13:113646307-113646329 GAGCAGAATTGCCGGGCATAGGG - Intergenic
1114011644 14:18375545-18375567 GAGCAGAAACACAAAGCAAAAGG - Intergenic
1114482369 14:23043877-23043899 GAGAGGAAAGGCAGGGCAGAGGG - Exonic
1114483666 14:23050235-23050257 CAGCATAAATGAAAGACAGAGGG + Intronic
1115116519 14:29886689-29886711 GCAAAGAAATGCAAGGTAGACGG + Intronic
1115522156 14:34243723-34243745 GAGCCTAAATGGAAGGCAGCAGG + Intronic
1115573784 14:34691710-34691732 GAGAAGAAACGAAATGCAGATGG - Intergenic
1117858521 14:60062761-60062783 GAGCAGGGATGCCAGGAAGATGG - Intronic
1118171953 14:63396235-63396257 GAGGAGAAAAGCAGGGGAGAGGG + Intronic
1118213629 14:63788181-63788203 GAGGAGAGAGGCCAGGCAGAGGG + Intergenic
1118381344 14:65220017-65220039 GAGATGAAATGCCAAGCAGAGGG + Intergenic
1118900396 14:69981056-69981078 GAGGAGAAAGGCAGAGCAGAAGG + Intronic
1119141434 14:72270913-72270935 GAGCTGAAATGCATGACAAAAGG - Intronic
1119513395 14:75229286-75229308 GGGCAGAAGAGCCAGGCAGATGG + Intergenic
1119869748 14:78006809-78006831 AAGGAGAAATGAAAGACAGAGGG - Intergenic
1120666872 14:87316715-87316737 AAGCAGAAAAACTAGGCAGAAGG - Intergenic
1121231890 14:92364506-92364528 CAGCAGCTATGCAGGGCAGAGGG + Intronic
1121783833 14:96639900-96639922 GAGCAGGAGAGCAAGGCAAAAGG - Intergenic
1121887394 14:97556067-97556089 GAGCAGAGATGCAAGAGACAGGG - Intergenic
1121907174 14:97757169-97757191 GAGCATAAATAAAAGGAAGAGGG - Intronic
1122519532 14:102333785-102333807 GCTCAGACATGAAAGGCAGAGGG - Intronic
1122841761 14:104468247-104468269 GAGCAGAAATCCAGGGAACATGG - Intergenic
1123093639 14:105753771-105753793 GGGCAGAAGGGCAGGGCAGAAGG - Intergenic
1123432010 15:20225995-20226017 GAACACAAATGCAAGCCAGAAGG - Intergenic
1123987182 15:25656310-25656332 TAGCAGACATTCCAGGCAGAGGG + Intergenic
1124905805 15:33867518-33867540 GACCTGAAATCCAAGGAAGATGG - Exonic
1125011638 15:34883176-34883198 GAGATGAAACCCAAGGCAGAGGG + Intronic
1125205581 15:37150362-37150384 GAGAAGACATGAAAGGCCGAGGG + Intergenic
1126859391 15:52869608-52869630 TAGCAGAAAGGAAGGGCAGAAGG + Intergenic
1126860701 15:52879974-52879996 GAGCAGAAAGAGAAGGAAGAGGG - Intergenic
1128210365 15:65895671-65895693 GAGGAGAAGGGAAAGGCAGAGGG - Exonic
1128523075 15:68388307-68388329 GAGAAGGAATTCCAGGCAGAAGG - Intronic
1129026844 15:72584177-72584199 GAGCAGGAATTCAAGGCATGAGG - Exonic
1129087443 15:73110352-73110374 TAGCAGAAACTCAGGGCAGAAGG - Intronic
1129455830 15:75675814-75675836 GAGCAGAAGTACCAGGCACATGG + Exonic
1129698457 15:77754101-77754123 GAGCAGAAAGGCAAGGGGGAAGG + Intronic
1130169861 15:81499917-81499939 GAACAGAAATGCAGAGCAAAGGG + Intergenic
1130740343 15:86592390-86592412 GAGCAGGAATGAAATGAAGAAGG + Intronic
1130966240 15:88699949-88699971 GAGCTGAACTAGAAGGCAGAGGG + Intergenic
1133416182 16:5608860-5608882 GAGCAGAGATGCATTTCAGAAGG - Intergenic
1133735043 16:8608496-8608518 GATCAGAAATGCCAGGTAGGTGG + Intergenic
1133775570 16:8892434-8892456 GAGCTGGAAGGCAAGGCCGATGG + Exonic
1133908006 16:10039182-10039204 GAGTGGAAAAGAAAGGCAGAGGG + Intronic
1135420415 16:22302100-22302122 GAGGAGAAATTCCAGGAAGAGGG - Intronic
1135940005 16:26814441-26814463 CTGCAGAAATGCAATGGAGATGG - Intergenic
1136366565 16:29811854-29811876 GAGCAGGAGGGCAAGGAAGATGG - Intronic
1136377756 16:29875611-29875633 GAGCAGAAAGGAATGGCAGCTGG - Intronic
1136852626 16:33625144-33625166 GAACCCAAATGCAAGCCAGAAGG + Intergenic
1137473908 16:48790141-48790163 TAACAGCAATGAAAGGCAGAAGG - Intergenic
1137879611 16:52032638-52032660 GAGAAGAAAGGCAGGGCAGATGG - Intronic
1138208109 16:55139855-55139877 TAGCAGAGCTGCAAGACAGAAGG + Intergenic
1139019402 16:62728660-62728682 GAGAAGAAATGGGAGGGAGAGGG + Intergenic
1139906931 16:70372531-70372553 GAACAGAAGTGAAAGGGAGAAGG - Exonic
1203114230 16_KI270728v1_random:1473612-1473634 GAACCCAAATGCAAGCCAGAAGG + Intergenic
1142493661 17:294518-294540 GTGCAGAAATGGACGGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1143273895 17:5695783-5695805 GAGGAGAAATGCCAAGCAAAGGG - Intergenic
1144262927 17:13540808-13540830 GAGCAAAAGGGAAAGGCAGAAGG + Intronic
1144696856 17:17310298-17310320 CAGCAGAAAGCCAAGGCAGGAGG + Intronic
1145191159 17:20842855-20842877 GAGTCCAAATGCCAGGCAGAGGG + Intronic
1145751717 17:27359948-27359970 GAGCAAGACTGCAAGGCACAGGG - Intergenic
1146289233 17:31596274-31596296 GAGCAGGAATGCGTGGCAGGAGG - Intergenic
1146478383 17:33181600-33181622 GATTTGAGATGCAAGGCAGAAGG - Intronic
1146805465 17:35861634-35861656 GAGAAGACATTCCAGGCAGAAGG - Intronic
1147252253 17:39159982-39160004 TACCAGAAATGGAAGGGAGAAGG - Intronic
1148544443 17:48506622-48506644 GAGCAGAAATGAAAGGACCAAGG + Intergenic
1148624742 17:49060694-49060716 GAATGGAAAAGCAAGGCAGAGGG + Intergenic
1150343860 17:64389090-64389112 GAGCAGAGAAGCCTGGCAGAGGG + Intronic
1150932703 17:69602521-69602543 GAGAAAAAATGAAAGGCAGAAGG - Intergenic
1151834556 17:76574314-76574336 GAGCAGGAAGCTAAGGCAGAAGG + Intronic
1152361960 17:79836974-79836996 GAGGAGAGATGGAAGGCAGCGGG + Intronic
1153225778 18:2898467-2898489 GAGCAGGAAGGGAAGGCAGAGGG + Intronic
1153373792 18:4352986-4353008 GGGCAGAACTGCATGGCAAAAGG + Intronic
1154946115 18:21163022-21163044 AAATAGAAATGAAAGGCAGAAGG + Intergenic
1155225893 18:23728673-23728695 CAGTAGAAAAGCAAGTCAGAAGG - Intronic
1155599990 18:27534103-27534125 GGGCAGAAATGTAAGGGATAAGG - Intergenic
1155766967 18:29648415-29648437 GAGGAGAAATGCAAGGAAAAAGG - Intergenic
1156039337 18:32802705-32802727 AAGCAGAAATCTAAGGAAGAAGG - Intergenic
1157051953 18:44176514-44176536 GAGCAGGAATGGAAGGTAGACGG + Intergenic
1158888065 18:61847821-61847843 GAGCAGAGATTCCAAGCAGAGGG - Intronic
1159805896 18:72957863-72957885 GAGGAGAAATTCAAGCCAGCTGG - Intergenic
1160471821 18:79142042-79142064 GAGCAGATATATAAGGCAGGTGG + Intronic
1161237621 19:3205664-3205686 GAGCAGAAAACCGAGTCAGAAGG + Intronic
1161448990 19:4334174-4334196 GATCAGAAACTCAAGGCAGGAGG - Intronic
1162021869 19:7871770-7871792 GAGCAGAAAGGCCTGGCTGAGGG + Exonic
1163167205 19:15506664-15506686 GAGCAGAGAAGCCAGGCAGATGG + Intergenic
1164291453 19:23872679-23872701 CAGGAGATATGCAAGGGAGAAGG - Intergenic
1164301690 19:23967737-23967759 CAGGAGATATGCAAGGGAGAAGG - Intergenic
1164473315 19:28553956-28553978 AGGCAGAACTGCAAGACAGAAGG - Intergenic
1164565370 19:29322180-29322202 GACCAGAAATGCAAGGTGGCTGG + Intergenic
1165022340 19:32935119-32935141 GGGCAGAAAGGCAGGGCAGGGGG + Intronic
1166170379 19:41024217-41024239 GAGCTGCAAAGCCAGGCAGAGGG - Intergenic
1166209270 19:41295601-41295623 AAGCACAAATGCAAGGCTGAAGG - Intronic
1167388346 19:49177961-49177983 GACCTCAAATGCCAGGCAGAGGG + Intronic
1167707298 19:51089142-51089164 GGGGAGAAAAGGAAGGCAGATGG - Intergenic
1167721272 19:51182066-51182088 CAGCAGATCTGCGAGGCAGATGG + Intergenic
1167750404 19:51375992-51376014 GAGCACAAAGGCAAGGCAGCTGG + Intergenic
1167765881 19:51482015-51482037 GAGCAGAATTTCAAGGCTCAAGG - Intronic
1168125654 19:54281099-54281121 GAGGAGAAATGCAGGGAAGTAGG + Exonic
925713353 2:6763005-6763027 AAACAGAAATGCAATTCAGATGG + Intergenic
926061931 2:9809718-9809740 GAGCAGACAGGCAGGGCTGACGG + Intergenic
926065739 2:9838248-9838270 CAGCAGAAGTTAAAGGCAGAAGG + Intergenic
926347744 2:11964062-11964084 GTACAGACATGCAAGGCAAAGGG + Intergenic
926382324 2:12302866-12302888 GAGCAGAAATGACAGACAGTAGG - Intergenic
926505127 2:13704653-13704675 GAGCAGAAATGTAAGTAAGTTGG + Intergenic
926902269 2:17765625-17765647 TAGCAGAAATGTCTGGCAGAAGG - Intronic
927271947 2:21220567-21220589 GAGTTAAAATGTAAGGCAGATGG - Intergenic
927464920 2:23329649-23329671 GAGCAGAGACGAAAAGCAGAAGG + Intergenic
928157655 2:28891523-28891545 AAGCAGAAAGACAAGGTAGAAGG - Intergenic
928257634 2:29737969-29737991 GAGCAAAAATGCAAGCCTGGTGG + Intronic
928773388 2:34729521-34729543 GATAAAAAATGCAAGGAAGAGGG - Intergenic
930021359 2:47003959-47003981 GAGAAGAAATTCTAGGGAGAGGG - Intronic
930461065 2:51676693-51676715 CAGGAGAAATGCAGGGCAAATGG + Intergenic
931428390 2:62191342-62191364 GTGAAGAAATGAAAGGCACAAGG - Intergenic
932568925 2:72926987-72927009 CAGTAGAAATGCATGGCAGGGGG - Intronic
933087132 2:78068166-78068188 AAACAGAAATGTAAGGCAGTGGG + Intergenic
933294524 2:80473964-80473986 GGGCAGGAATGTAAGACAGATGG - Intronic
933581239 2:84129361-84129383 TCCCAGAAAAGCAAGGCAGAGGG - Intergenic
933998371 2:87686435-87686457 GAGCAGGAAAGCAATGCAGAAGG + Intergenic
934155312 2:89194124-89194146 GAGCGGAAATGCCAGGTTGAAGG + Intergenic
934212009 2:89988622-89988644 GAGCAGAGATGCCAGGTTGAAGG - Intergenic
934903103 2:98176534-98176556 TAGCTGAAAAGGAAGGCAGAAGG - Intronic
935073834 2:99720692-99720714 GACCAGAAATGAAAAACAGAAGG - Intronic
936295478 2:111264438-111264460 GAGCAGGAAAGCAATGCAGAAGG - Intergenic
936366286 2:111859754-111859776 GATCAGATATGTAAGGCAGGAGG - Intronic
936643963 2:114347929-114347951 GAAGAGAAAGGAAAGGCAGAGGG + Intergenic
939013135 2:136870923-136870945 AAGCAGAAAAGCCAGGCAGGAGG + Intronic
939458089 2:142463904-142463926 AAGCTGAACTGCAATGCAGAAGG + Intergenic
939672824 2:145034632-145034654 GACAATAAATGCAATGCAGAAGG + Intergenic
939802955 2:146735675-146735697 GAGCTGAAGTAGAAGGCAGATGG - Intergenic
940225023 2:151392224-151392246 AACCAGAAATGCAAGGTAGAAGG + Intergenic
940979641 2:159986885-159986907 AAGCAGAAATACCAGGCACAGGG - Intronic
941508886 2:166381125-166381147 GAGCAGGCATGCAAAGAAGAAGG + Intergenic
942543959 2:177043588-177043610 GAGAGGAAAAGGAAGGCAGAAGG - Intergenic
942928807 2:181464545-181464567 GAGAAGAAATGAATGGGAGAAGG + Intronic
943537499 2:189170704-189170726 GAGCAGTCTTGCAAGGCAGCTGG + Intronic
944936424 2:204573732-204573754 AAGGAGAAGAGCAAGGCAGAAGG - Intronic
945468420 2:210198588-210198610 GCCCAGAAGTGCAAAGCAGATGG - Intronic
946812889 2:223545153-223545175 GGGTACAAATGCATGGCAGAGGG - Intergenic
946972106 2:225105410-225105432 GAGCACAAATACAAAGTAGAAGG + Intergenic
947016937 2:225631510-225631532 TAGAAGAAATGCAAAACAGAGGG + Intronic
947709902 2:232307088-232307110 GAGCAGACAGGCACGGCACAGGG - Intronic
948610604 2:239163972-239163994 CAGCAGCAATGCAGGGCAGCGGG + Intronic
949074439 2:242046001-242046023 GAGCAGGAATGAAACACAGAAGG + Intergenic
1169675774 20:8152843-8152865 GAGCAGAAATCCCTAGCAGAGGG + Intronic
1170175222 20:13461173-13461195 GAGCAGAAATCCAAAGGTGATGG - Intronic
1173200767 20:40953482-40953504 GAGCTGAAATGCAAAGGAGGGGG + Intergenic
1173313508 20:41921933-41921955 GAGGAGAAAAGAAAGGCAGAAGG - Intergenic
1174764004 20:53234748-53234770 GAGCAGAAAATCCAGGAAGAGGG + Intronic
1175631471 20:60541574-60541596 CAGCAGAAATGCAAAAGAGATGG - Intergenic
1175819979 20:61903974-61903996 GAGCAGAAACGCAAAACAGCTGG - Intronic
1176209483 20:63911441-63911463 GAGCAGACAGGCAGGGCAGCTGG - Intronic
1177900984 21:26914747-26914769 AAGCAGAAGAGAAAGGCAGAAGG - Intergenic
1179992816 21:44957484-44957506 GAGCTGGACTGCAAGGCACAGGG - Intronic
1180033375 21:45227930-45227952 GAGAAGGCTTGCAAGGCAGATGG + Intergenic
1180436137 22:15306353-15306375 GAGCAGAAACACAAAGCAAAAGG - Intergenic
1181056724 22:20263749-20263771 GAGAAGAAAGGCAGGGCAGTTGG - Intronic
1181406009 22:22685647-22685669 GAGCTGGAAGGAAAGGCAGAGGG - Intergenic
1181413985 22:22746350-22746372 GAGCTGGAAGGAAAGGCAGAGGG - Intronic
1181419630 22:22788873-22788895 GAGCTGGAAGGAAAGGCAGAGGG - Intronic
1181568342 22:23752828-23752850 GGGCAGAAATGGGAGGCAGAGGG + Exonic
1181668967 22:24416928-24416950 GTGCAGAGCTGCAAGGGAGAGGG + Exonic
1181902980 22:26170445-26170467 GATCAGAGATGCTAGGCAGTAGG - Intronic
1181926680 22:26365352-26365374 CCGCTGAAATGCAAGCCAGAAGG - Exonic
1182665511 22:31956250-31956272 GAGCAGAAAACCATGGCTGATGG + Exonic
1182892572 22:33831364-33831386 GAACAGGAAGGCAAAGCAGAGGG - Intronic
1183506444 22:38211756-38211778 GTGCAGAAATGGAAAGCACATGG - Intronic
1185367938 22:50445540-50445562 GAGGACAAATGCCAGGCACAGGG - Exonic
949988568 3:9559170-9559192 GTGCAGAAATGGAACTCAGATGG - Intergenic
950568155 3:13783693-13783715 GAGTAAAAATGCATGGCAGCTGG - Intergenic
952538533 3:34339965-34339987 GAGCAGAAATACAAGGGGCAGGG + Intergenic
952615077 3:35261237-35261259 AAGCAGAAATGCAAGGATAAAGG - Intergenic
953563064 3:44010132-44010154 GGGTCGAAATGCAAGTCAGATGG - Intergenic
953739372 3:45523864-45523886 AAGCAGAAATGGATGGCAAAGGG + Intronic
955060812 3:55489909-55489931 GGGCAGAACGGCAAGGGAGAGGG - Intronic
955435546 3:58895198-58895220 GAGGAGAAATTCAAGCCAGCTGG - Intronic
955571432 3:60310858-60310880 GTGCACAAATGATAGGCAGATGG - Intronic
956634058 3:71345753-71345775 GTGCAGAAATTCAGTGCAGATGG + Intronic
956797602 3:72730809-72730831 AAGCAGACATGGAAGGAAGAAGG - Intergenic
956798339 3:72735914-72735936 AAGCAGACATGGAAGGAAGAAGG - Intergenic
957765451 3:84619279-84619301 GTGCAAAAAAGAAAGGCAGAGGG + Intergenic
959193819 3:103151145-103151167 GAACATAGTTGCAAGGCAGAGGG + Intergenic
960088538 3:113615872-113615894 CAGCAGAAAGGCAAGGAAGATGG - Intronic
960944829 3:122958699-122958721 GACCAGAGAGGCAAGGCAGAGGG + Intronic
961146664 3:124599488-124599510 GAACAGAAATGAGAGACAGATGG - Intronic
961426086 3:126849329-126849351 AAACAGAAATGCAAAGCAGTGGG - Intronic
961485832 3:127215532-127215554 AAACAGAAATGAAAGTCAGAGGG + Intergenic
961769030 3:129234814-129234836 AAGCAGTAATGCAAGAGAGATGG - Intergenic
961863644 3:129937924-129937946 GAGCAGCCATGCAAGGCCGCAGG - Intergenic
962455993 3:135566245-135566267 AAGGAGAATTGGAAGGCAGATGG + Intergenic
963069588 3:141292003-141292025 GAGGCCAAGTGCAAGGCAGATGG + Intronic
963254163 3:143128248-143128270 GAGAAGAAATGGGAGGCAGGGGG - Intergenic
963833345 3:150032016-150032038 GGGCAGGAATGAAAGGAAGAGGG - Intronic
964292918 3:155201587-155201609 GAGCAGAAAGTCAAGGCTGCAGG - Intergenic
964835038 3:160928947-160928969 AGGCAGAGATGCAAGGCAGATGG + Intronic
966269668 3:178090144-178090166 GAACAGAAAGGCAAGGCAAAAGG + Intergenic
966892226 3:184415879-184415901 GAGCAGGTATTCCAGGCAGAGGG - Intronic
967830192 3:193912152-193912174 AAGCAGAGATGGCAGGCAGAAGG - Intergenic
967852762 3:194094448-194094470 GGCCAGAAATGCAAGCCACATGG + Intergenic
967949197 3:194827775-194827797 GAGCTGGAATGTAAGGCAGCAGG - Intergenic
968269145 3:197387969-197387991 GATCCCAAATACAAGGCAGATGG - Intergenic
968611646 4:1559928-1559950 GAGGTGAGAGGCAAGGCAGACGG - Intergenic
969121432 4:4914258-4914280 GATGAGTAATCCAAGGCAGAGGG + Intergenic
969279451 4:6160461-6160483 AAACTGAAGTGCAAGGCAGACGG + Intronic
970479939 4:16462565-16462587 GAAAAGAAATGGAAGGCAAATGG + Intergenic
972170714 4:36342353-36342375 GTTCAGTAATGGAAGGCAGATGG + Intronic
972987134 4:44778320-44778342 GAGCAGGAATGAAAGAAAGAGGG - Intergenic
973222372 4:47743279-47743301 GAGTAGAAAGGCAAGCCATAGGG + Intronic
974544497 4:63283081-63283103 GAGCAAAGATGCAAGGAAGCAGG - Intergenic
974842070 4:67310210-67310232 GAGGAGAAATTCAAGCCAGCTGG + Intergenic
976476526 4:85490108-85490130 GGGCAGAAATGGGAGGGAGAGGG + Intronic
976597747 4:86910072-86910094 AAGCAGAAATGAAATGCAGTGGG - Intronic
977243164 4:94598687-94598709 GAGCAGACATGCAATGAAAAAGG + Intronic
983101423 4:163630875-163630897 CAGAAGAAATGCAAGGAAAAAGG + Intronic
985756142 5:1719490-1719512 GACTAGACATGCAAGACAGAAGG - Intergenic
986502439 5:8414982-8415004 AAGGAGGAATGGAAGGCAGAAGG - Intergenic
987420923 5:17719268-17719290 GAGGAGATGTGCAAGACAGAAGG - Intergenic
987906603 5:24086151-24086173 GAGAAGAAAAGCAAGAAAGATGG + Intronic
991049255 5:62255009-62255031 GAACCCAAATGCAAGCCAGAAGG - Intergenic
991970323 5:72134821-72134843 GAGTAGAAAAGGAAGGCAGGCGG + Intronic
992632727 5:78697612-78697634 GAGAAAAAATGGAAGGCAGCAGG - Intronic
992907063 5:81357026-81357048 GAGAGAAAATGCAAGGTAGAGGG - Intronic
993052302 5:82939811-82939833 GAGCAGATATGAAAGACAGAGGG - Intergenic
993120571 5:83769144-83769166 GAGCATAGATGGAAGGCAAAAGG - Intergenic
993388578 5:87290130-87290152 GGGTAAAGATGCAAGGCAGAAGG - Intronic
993473068 5:88330659-88330681 GGGCAGAACTACAAGGTAGAAGG - Intergenic
995299942 5:110567785-110567807 GACCAGAAATACCAGGAAGAAGG - Intronic
995460589 5:112399239-112399261 AGGCAGAAGTTCAAGGCAGAGGG - Intronic
995692322 5:114841379-114841401 TAACAGAGATGCAAGGAAGATGG + Intergenic
995740909 5:115354772-115354794 GCACAGAAATTCTAGGCAGAAGG - Intergenic
995832055 5:116364155-116364177 TAGCAGATATGGATGGCAGATGG + Intronic
995836518 5:116405335-116405357 GAGGAGAAGGACAAGGCAGAGGG - Intronic
995976212 5:118038486-118038508 GATCAGTAATGAAAGGCAAAGGG - Intergenic
996015968 5:118534420-118534442 GATTAGAATTGCAAGGCAGGTGG - Intergenic
996796302 5:127352247-127352269 CAGCAGAAATGTAAGGAAGTGGG - Intronic
998046579 5:138991791-138991813 GAGAAGAAATACAACGGAGAAGG + Intronic
998488153 5:142521765-142521787 GCTCAGATAAGCAAGGCAGAGGG + Intergenic
998867704 5:146521918-146521940 GTGCAGAACTGCAAAGCTGAGGG - Intergenic
999678513 5:154031934-154031956 AAGCAGAAAGGCCAGACAGAAGG + Intronic
999795526 5:154985976-154985998 GAGCAGAAGTGTAAGGCATTGGG - Intergenic
999953913 5:156679759-156679781 GAGAAGAAAAGCAAGAAAGAAGG - Intronic
1000825130 5:166035208-166035230 GTGCAGAAATGCAGGCAAGAAGG - Intergenic
1002825022 6:764669-764691 GGGCAGAAAATCAACGCAGAAGG + Intergenic
1002829880 6:810249-810271 GAGAAGAAAAGACAGGCAGAGGG + Intergenic
1004267359 6:14160392-14160414 AAGTAGAAAAGCAAGCCAGAGGG + Intergenic
1004915898 6:20331876-20331898 CAGCAGAAAAGAAAGCCAGAAGG + Intergenic
1005247436 6:23904172-23904194 GAGCAACAATGGAAAGCAGAAGG + Intergenic
1005814795 6:29541768-29541790 GTGCAGAAATGGAAGGTAGATGG - Intergenic
1007123102 6:39399968-39399990 GAGCAGATAAGGAAGACAGAGGG + Intronic
1007257049 6:40536742-40536764 GAGAAGAATTGCCAGACAGAGGG + Intronic
1008677702 6:53838069-53838091 GATCTCAAAGGCAAGGCAGAAGG + Intronic
1009058175 6:58364451-58364473 GAGAAGAAATGGAAAGCTGAGGG + Intergenic
1009232650 6:61082662-61082684 GAGAAGAAATGGAAAGCTGAGGG - Intergenic
1009848135 6:69160299-69160321 GGGCAGAGATGAAAGGCAGGAGG - Intronic
1010287524 6:74096495-74096517 TAGCAGAAATGTAAGTCAGAAGG + Intergenic
1010399224 6:75429285-75429307 AAACAGAAATGCAAGGGGGATGG + Intronic
1010443714 6:75927958-75927980 GATCAGTAAAGCAAGGCATAAGG - Intronic
1010544350 6:77131465-77131487 CAGCAGAATGGCAAAGCAGAAGG - Intergenic
1011097116 6:83678684-83678706 GAGCAGGAGTGGAAGGTAGAAGG - Intronic
1011183051 6:84643027-84643049 GTGCAGAAATGCATTGCAGGAGG + Intergenic
1011791236 6:90901403-90901425 GAGCAGAAAGTAAAGTCAGAGGG - Intergenic
1012236051 6:96817046-96817068 GAACAGAAAGGCAAGCCAAAAGG + Intronic
1013210475 6:107982580-107982602 GAGCAGATTTGCAGGGCAGCAGG + Intergenic
1014422634 6:121264086-121264108 GAGCAGAAATGAAGGAGAGACGG + Intronic
1015712152 6:136153869-136153891 GAGCAGAGATGGACAGCAGAGGG - Intronic
1016257994 6:142132295-142132317 AAGCAGATATGTAAGTCAGAAGG + Intergenic
1016832061 6:148444079-148444101 AAGCAGAAATGCAAAGAAGGAGG + Intronic
1017804133 6:157928600-157928622 GAGCAGAAGTGCGAGGCTGTGGG + Exonic
1018218032 6:161550067-161550089 GATTAGAAATGCAAGTCACATGG + Intronic
1018852596 6:167652286-167652308 GAGCAGAAATGAAGTGGAGAGGG + Intergenic
1019000428 6:168744788-168744810 GAGCAGACCAGCAAGGAAGATGG + Intergenic
1019186728 6:170224787-170224809 GACCAGGAATGCAGGGCAGAGGG - Intergenic
1020908549 7:14097852-14097874 CAGCAGAAATGAAATGCATAAGG - Intergenic
1022979338 7:35589466-35589488 AAGAAGAAATGAAAGGCAGAAGG - Intergenic
1023376909 7:39565824-39565846 GAACAGGAATGGGAGGCAGAAGG + Intergenic
1023604140 7:41912444-41912466 AAGCAGAGAAGCAAAGCAGAAGG - Intergenic
1023869444 7:44255199-44255221 GAACAGAGATGACAGGCAGAAGG + Intronic
1023993311 7:45143578-45143600 GAGGAGAAATGCAAGAGACATGG - Intergenic
1025028502 7:55537063-55537085 GACGAGAAACGCAATGCAGATGG + Intronic
1025965129 7:66262557-66262579 GAAAAGACATGCTAGGCAGATGG - Intronic
1026452017 7:70537805-70537827 GAGCAGAAATGGAAGTAAGAAGG + Intronic
1027303124 7:76862539-76862561 AAGCTGAAATCAAAGGCAGAAGG - Intergenic
1030524679 7:110638840-110638862 GAGAGGAAAAGGAAGGCAGAAGG - Intergenic
1031331769 7:120474246-120474268 GAGCAGAATGGCCAGGCAGTGGG - Intronic
1033438072 7:141352208-141352230 GAGCTGAAATGCAATGGAGAAGG + Intronic
1033670218 7:143485297-143485319 AAGCAGAAGTCCAAAGCAGAAGG + Intergenic
1033742284 7:144284479-144284501 GAGCAGAAATGGGAGGAAGGTGG + Intergenic
1033751618 7:144365135-144365157 GAGCAGAAATGGGAGGAAGGTGG - Exonic
1033897669 7:146094606-146094628 GACCAGAAGAGAAAGGCAGACGG - Intergenic
1034625711 7:152490799-152490821 AAGCAGAGAGGCAAGGCAAAAGG - Intergenic
1035311346 7:157970936-157970958 GTGCAGATTTGCCAGGCAGATGG - Intronic
1036124221 8:6048292-6048314 GAGCAGAAAACCAAGGCAGCAGG + Intergenic
1036738106 8:11337468-11337490 GAAGACAAATGCAAGGCAGAGGG - Intergenic
1036962460 8:13259985-13260007 CAGGAGAAATGAAAAGCAGAAGG + Intronic
1037029742 8:14090376-14090398 GAGCAGAACTGTGAAGCAGACGG + Exonic
1037441165 8:18917704-18917726 GAGCAGGAATGCAAGGGGCAGGG - Intronic
1039438811 8:37580434-37580456 GAAAAGTAATGCAGGGCAGATGG + Intergenic
1040639703 8:49319190-49319212 CAGCAGAAATGCATGGGAGGTGG - Intergenic
1041967706 8:63699383-63699405 AAGAAGAAATGCACGCCAGATGG - Intergenic
1043004017 8:74795989-74796011 GAGCAGCAATGGAAAGCAGAGGG + Intronic
1044517501 8:93156358-93156380 AAGCAGACATGGAAGACAGAGGG - Intronic
1044978210 8:97687894-97687916 GAACAGAGATGCAAGGGAGTTGG - Intronic
1045350531 8:101334112-101334134 GAGCAGGAAAGCAAGGCCGGAGG - Intergenic
1045357354 8:101401615-101401637 CTTCAGAAATGCAATGCAGATGG + Intergenic
1047552442 8:125889605-125889627 GAGCAGCAAAGAAAGGAAGAAGG - Intergenic
1049117701 8:140703741-140703763 GAGAAAAATTTCAAGGCAGAGGG + Intronic
1049118167 8:140708324-140708346 GAGGAGACATTCCAGGCAGAGGG - Intronic
1049351496 8:142167134-142167156 GAGCAGAAGTGCCAGGCAGATGG + Intergenic
1050643521 9:7693943-7693965 GACAAGAACAGCAAGGCAGAAGG - Intergenic
1050799231 9:9588228-9588250 CAGCAGAATTGGAAGACAGAAGG + Intronic
1051168767 9:14296322-14296344 GAACAGAAAAGCAAAGCACATGG + Intronic
1052882174 9:33608305-33608327 GGGTAGCAATTCAAGGCAGAGGG - Intergenic
1053061590 9:35036248-35036270 TAGCAGAAGGGAAAGGCAGAGGG + Intergenic
1053149670 9:35735210-35735232 GAGCAGGTATGAAAGGGAGAGGG + Exonic
1053209966 9:36219292-36219314 GAGCTGCAAAGCCAGGCAGAGGG - Intronic
1054871306 9:70049339-70049361 GTGCAGAACTGAAACGCAGATGG - Intronic
1054882847 9:70163164-70163186 GAGCAGAAATGCAAGGCAGATGG - Intronic
1056089193 9:83187743-83187765 GAGGAGAAATGGAAGGTAGAGGG - Intergenic
1056450592 9:86712861-86712883 GAGAAGGAATGCAAGGGAGTGGG + Intergenic
1056793253 9:89639777-89639799 GAGGAGAAAGGAAAGACAGAGGG - Intergenic
1056803678 9:89711745-89711767 GATGAGAAATCCAAGGCACAAGG - Intergenic
1056938333 9:90935089-90935111 GAGGAGGAAAGCAAGGCATAGGG - Intergenic
1057542040 9:95984416-95984438 GATCAGAAATATAAGGCTGAAGG - Intronic
1057612657 9:96560241-96560263 GAGCAGAACTCCAAAGCAGAGGG - Intronic
1058283646 9:103150041-103150063 GAGGAGAAATTCAAGCCAGCTGG + Intergenic
1058883845 9:109307966-109307988 GAGCAGCCTTCCAAGGCAGATGG + Intronic
1059772676 9:117442539-117442561 GAGAAAATATTCAAGGCAGATGG - Intergenic
1061495823 9:130973676-130973698 GAGCTGCGATACAAGGCAGAGGG - Intergenic
1061743451 9:132723659-132723681 GACCAGGAATGCCAGGCAGAAGG + Intergenic
1062165094 9:135103649-135103671 GAGCAGAACTGCAAGGTCCAGGG + Intronic
1185867512 X:3636922-3636944 GAACAGAAAGGAAAGGAAGAAGG + Intronic
1186223198 X:7371427-7371449 GGGAAGAAATTCTAGGCAGAAGG + Intergenic
1187589379 X:20699740-20699762 ATGCAGAAATTGAAGGCAGATGG + Intergenic
1188496743 X:30790138-30790160 GCAAAGAAATGCAAGGCAGAAGG - Intergenic
1188498911 X:30805147-30805169 GAAAAGAAAGGCAAGGCACAAGG - Intergenic
1189946269 X:46182839-46182861 TAGCAGCAATGGAAGGCAGATGG - Intergenic
1189965322 X:46366556-46366578 GAGCAGATGGGCAAGACAGATGG - Intergenic
1190594881 X:52042374-52042396 GAGGAGAACGGAAAGGCAGAGGG - Intergenic
1190613943 X:52211699-52211721 GAGGAGAACGGAAAGGCAGAGGG + Intergenic
1191869910 X:65737153-65737175 GAGCAGAAAAGGAGGGGAGAAGG - Intronic
1191975631 X:66868078-66868100 GAGCAGAAAGACTAGGCACAGGG + Intergenic
1193253854 X:79324252-79324274 GAGAAGAAAACCAAGGCTGAAGG + Intergenic
1195112927 X:101665550-101665572 GAGTAGAAATTCAATGCTGATGG - Intergenic
1197836287 X:130697274-130697296 GAGGGGAAATGCTAGGTAGATGG - Intronic
1198681623 X:139189007-139189029 GGGCAAAAATGCAAGGATGAAGG + Intronic
1198965262 X:142221637-142221659 GAGCAGAAAGAGAAGGCAGAGGG + Intergenic
1199272415 X:145899319-145899341 CTGCAGAAATGGAAGGCAGCAGG - Intergenic
1199342168 X:146693796-146693818 AAGCAGAAATGCAGTCCAGATGG + Intergenic
1199971824 X:152867139-152867161 AAACAGGAAGGCAAGGCAGAGGG - Intronic
1201592757 Y:15633696-15633718 GGGAAGAAATTCCAGGCAGAAGG + Intergenic
1201678953 Y:16620743-16620765 GAGAAGGAATGCAAGGCATGAGG + Intergenic
1201795896 Y:17895924-17895946 GAGCTGAAAGCCAAGGCACAAGG + Intergenic
1201805659 Y:18010061-18010083 GAGCTGAAAGCCAAGGCACAAGG - Intergenic
1202357308 Y:24064989-24065011 GAGCTGAAAGCCAAGGCACAAGG + Intergenic
1202513469 Y:25605125-25605147 GAGCTGAAAGCCAAGGCACAAGG - Intergenic