ID: 1054883716

View in Genome Browser
Species Human (GRCh38)
Location 9:70173028-70173050
Sequence TTCAGGCACAGCTTGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054883710_1054883716 22 Left 1054883710 9:70172983-70173005 CCTTTTTTGGACTTTGTTACAGA 0: 1
1: 0
2: 2
3: 21
4: 217
Right 1054883716 9:70173028-70173050 TTCAGGCACAGCTTGATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054883716 Original CRISPR TTCAGGCACAGCTTGATGCA GGG Intronic
No off target data available for this crispr